ECOLOGY OF UPPER KLAMATH LAKE SHORTNOSE AND LOST RIVER SUCKERS 5. Molecular evolution and ecology of Klamath Basin suckers B. Evidence for a lethal homozygous genotype at the AnkyrinG locus in Klamath Basin suckers ( Catostomidae) 1999 ANNUAL REPORT ( partial) SUBMITTED TO U. S. Biological Resources Division US Geological Survey 104 Nash Hall Oregon State University Corvallis, Oregon 97331 - 3803 & Klamath Project U. S. Bureau of Reclamation 6600 Washburn Way Klamath Falls, OR 97603 BY D. Wolfe Wagman & Douglas F. Markle Oregon Cooperative Research Unit 104 Nash Hall Department of Fisheries and Wildlife Oregon State University Corvallis, Oregon 97331 - 3803 March 24,2000 ABSTRACT Three nuclear loci, coding for Ankyrin~, C ollagen 1, and Aldehyde dehydrogenase, were examined in four sucker species from Klamath and Rogue river basins. Frequencies of genotypes and alleles differed markedly between pre- adult and adult suckers for the Ankyrik locus but were usually similar for the other two loci. All adult Klamath Basin suckers greater than 163 mm FL ( n= 242), had only two Ankyrim genotypes, AA and AB, with no BB genotypes. However, all three Ankyrik genotypes were found in larvae ( n = 325) and juveniles up to 71 mm SL ( n = 71). When selection was simulated by removing the BB genotype from younger life stages, larva and juvenile AnkyrinG allelic frequencies resembled adult frequencies. Four populations representing two of the species, Klamath largescale and shortnose suckers, were examined in greater detail. Genotypic frequencies were in Hardy- Weinberg equilibrium for Collagen 1 and Aldehyde dehydrogenase in all four populations but not for Ankyrik in three of four populations. Similarly, differences in allelic frequencies between life stages were not significantly different in seven of eight comparisons with Collagen 1 and Aldehyde dehydrogenase while they were significantly different in three of four Ankyrin~ co mparisons. When young Ankyrim BB homozygotes were removed from the analysis, Collagen 1 and Aldehyde dehydrogenase allelic frequencies changed by less than 4% but Ankyrin~ a llelic frequencies changed 8- 26% and II o f 12 life stage comparisons were not significantly different. The simulation suggested a stable allelic frequency across generations and the distribution of genotypes suggested a heterozygous advantage perhaps caused by lethality of the homozygous BB genotype in pre- adults. The Ankyrino BB genotype may therefore represent a previously unsuspected source of significant early life history mortality. INTRODUCTION The Klamath Basin contains four endemic species of suckers representing three genera. Two are generally considered lacustrine ( Scoppettone and Vinyard, 1991) and are federally listed endangered species ( U. S. Fish and Wildlife Service, 1988), Deltistes luxatus, Lost River sucker ( LRS), and Chasmistes brevirostris, shortnose sucker ( SNS). Two are generally considered riverine and are not federally protected species, Catostomus snyderi, Klamath largescale sucker ( KLS), and C. rimiculus, Klamath smallscale sucker ( KSS). The distribution of the lacustrine species and C. snyderi is centered on Upper Klamath Lake and Lost River subbasins with some expatriated individuals showing up in downstream reservoirs. The distribution of C. rimiculus is disjunct in the lower Klamath R. below Keno, OR and in the adjacent Rogue R. Biologists have consistently had difficult identifying species of Klamath suckers and Miller and Smith ( 1981) contend that hybridization has occurred making identification more arduous. Consequently, the federal recovery plan ( U. S. Fish and Wildlife Service, 1993) for the lacustrine species includes the need to characterize and conserve genetic diversity of populations of all four Klamath Basin suckers. The initial goals of this molecular survey were to isolate and characterize species markers, identify hybrids, and investigate population structure. We surveyed 28 ( 1 0,373 base pairs ( bp)) low copy number anonymous nuclear loci in the four Klamath Basin species and in selected species outside Klamath Basin. Only four polymorphic loci were found and none showed fixed species markers for Klamath Basin suckers ( Wagman and Markle 2000) although the Ankyrin~ locus appeared useful for catostomid phylogeny. In the following, we show that Ankyrik has genotypic and allelic patterns suggesting a heterozygous advantage possibly acting through a lethal homozygous genotype in pre- adults. Catostomid genetics and the three proteins Catostomids are allotetraploids ( Uyeno and Smith, 1972; Tsoi, et al., 1989), presumably from an ancestral, tetraploid hybridization event in China ( Tsoi et al., 1989) approximately 50 mya. ( Uyeno and Smith, 1972). Allotetraploids possess two complete diploid genomes that segregate independently resulting in disomic inheritance ( Dawson, 1962 and Ronfort et al., 1998). The ancestral condition for any catostomid locus is tetraploid and disomic. Potentially derived states are diploidization and tetraploid tetrasomic inheritance. Tetrasomic inheritance produces multivalent or quadivalent meiotic structures and are common in autotetraploids such as salmonids ( Allendorf and Thorgaard, 1984), but are unknown in catostomids. Uyeno and Smith ( 1972) report no multivalents in meiotic chromosome spreads in Erimyzon and Tsoi et al. ( 1 989) did not see them in Myxocyrinus. Ferris and Whitt ( 1978) report a large number of heterozygous loci and ratios of isozyme activities consistent with allotetraploids. Each of the loci described below had two alleles and consequently, we assume the three loci have become diploidized and segregate independently. AnkyrinG is a member of the ankyrin multiple gene family of proteins. These genes exhibit tissue specificity, sequence divergence ( Bennett, 1992) and are characterized by their 33- amino acid motif, the ANK repeat. They are peripheral membrane proteins that interconnect integral proteins with the spectrin rich membrane skeleton. The gene family currently consists of three genes Ankyrin~ A, nkyrinRa nd A n k y r i ~( a lso known as Ankyrin 3, the short form of the molecule). AnkyrinR is associated with erythrocyte membrane skeleton and is localized in post- mitotic neurons of the brain ( Lambert and Bennett, 1993). AnkyrinB has two splice variants of 220kDa and 440 kDa ( Kunimoto, et al., 1991) and both are associated with unmyelinated and premyelinated axons ( Chan et al, 1993). Ankyrik, is large, 480 kDa, ( hence, " G" for giant) and has a splice variant of 270 kDa. Both molecules associate with the voltage- dependent sodium channel at the nodes of Ranvier, the axonal initial segments and the neuromuscular junction ( Kordeli et al., 1995). AnkyrinG has 5 major domains ( Figure 1). From the amino terminal, the molecule is composed of a membrane binding domain, a short spacer region connected to a spectrin binding domain, a serine rich region that connects to a variable length extended tail region that ends at the carboxyl terminal. Construction of size variants is suspected to be by splicing different regions from the extended tail region ( Kordeli et al., 1995). The Ankyrin~ c lone contained a 60 bp open reading frame ( ORF), containing a 20 amino acid translated sequence that was 88% identical ( 18120) to human Ankyrik ( Kordeli, et al., 1995) with an overall similarity of 99% ( Table 3). The clone sequence exhibited a higher identity score ( 94% and 93%) to that of the 270- kDa rat AnkyrinG isoform and mouse Ankyrik. Their region of identity is one amino acid shorter than the human Ankyri* long form ( 480 kDa). This region ( 480- 533) corresponds to the 4081- 4098 nucleic acid region of the human Ankyrin~ se quence in the extended tail region, upstream of the carboxyl end of the protein ( Figure I). This region is spliced out of the smaller 270- kDa size variant ( Kordeli et al., 1995). The two Klamath Basin alleles, A and B, differed by a single base pair transversion of cytosine to adenine at nucleotide position 357 of the clone ( Table 1). Collagen 1 had 59% identity ( 73% overall homology, 20127 aa) to Collagen 1 gene from Ephydatia muelleri ( Wagman and Markle 2000). We detected two alleles caused by a 10- bp deletion between positions 260- 270 ( Wagman and Markle 2000). Aldehyde dehydrogenase had 45% identity ( 69% overall homology, 26137 aa) to a tumor associated aldehyde dehydrogenase from Ratus nomegicus. We detected two alleles caused by a 4- bp deletion between positions 303- 307 ( Wagman and Markle 2000). MATERIALS AND METHODS Adult Klamath and Rogue suckers used for this study are listed in Wagman and Markle ( 2000, Appendix 1). The adult sampling targeted spawning groups. Attempts were made to collect 30 individuals from each spawning site and collections included many different age groups. In one case, non- spawning fish were sampled that could represent multiple spawning groups ( Eagle Ridge adults from Upper Klamath Lake). These fish have been grouped with Upper Klamath Lake samples. Larval suckers were collected with a dip net or drift nets from April to June, 1996 and 1997 from 14 sites approximating known spawning sites ( Appendix 1). Larvae were preserved in 70% ethanol or frozen in I- m l ultrapure water placed on dry ice and could not be identified to species. Juvenile suckers were collected with castnets in a stratified random sampling regime from Upper Klamath Lake ( Simon et al., 2000) during September and October of 1997 ( Appendix 1). Juvenile suckers were identified using gillrake and vertebral counts. Catalogued adult specimens are referenced by museum catalog number ( 0s = Oregon State University Fish Collection) or tissue archive number (#). Juvenile and larval specimens are referenced by field site number. DNA extraction, library construction, clone isolation, sequencing, PCR amplification, PAGE ( polyacrylamide gel electrophoresis) and SSCP ( single strand conformational polymorphism) procedures are described in Wagman and Markle ( 2000). AnkyrinG ( Figure 3), Collagen 1, and Aldehyde dehydrogenase loci had no more than two alleles in a specimen, each had only two alleles in Klamath Basin, and each produced three genotypes ( Table 2). Denaturing PAGE profiles for the size variant alleles ( Collagen 1 and Aldehyde dehydrogenase) produced three distinct genotypes without staining variation among the alleles. SSCP profiles for Ankyrim ( Figure 3) exhibited two single- stranded bands for each allele. Bands stained differently according to their overall charge with the slow band of the A allele ( higher in the gel) and the fast band of the B allele ( lowest in the gel) staining less intensely than their complements. Scoring of AnkyrinG genotypes was based on the fast band of the A allele and the slow band of the B allele. Standard population genetic statistics were generated from the data using the web-based Genepop ( version 3.0). We tested for Hardy- Weinberg equilibrium ( HWE) using a Hardy- Weinberg exact probability test ( web- based Genepop, version 3.0) which employs a Markov chain reiteration of a 1000 re- sampling of the data to determine the probability that chance alone could produce a deviation between the observed and expected values at least as great as the deviation actually realized. If the probability is large then chance alone could account for the deviation ( Hartl and Clarke, 1997). Statgraphics ( version 3.0) also performed comparisons between loci and species. RESULTS An kvrin- G Allele A was present in all adult suckers tested ( Wagman and Markle, 2000) and was the original AnkyrinG clone. Allele B was only found in Klamath and Rogue drainages and was found in all four Klamath species ( appendix 2a, and Wagman and Markle, 2000). The BB homozygote genotype was absent in all 242 adults sampled ( Tables 3, Figure 2), but present in 32% of larvae ( 1041325) and 50% of juveniles ( Table 3, Figure 2). The largest identified BB homozygote was a 71 mm ( TL) SNS from Rose Andersen Dam on the Lost River and the smallest adult was 163- mm fork length ( FL) KLS from Sycan River ( 0s 15898- D, tissue # I 23). Samples in the 60- 1 60 mm size class were generally unavailable for analysis, only two samples are in this range. We tested for sex related differences in adults and found no significant difference between allele frequencies and sex ( ANOVA; p = 0.178 for A and p = 0.201 for B). Basin wide frequencies of larval AA homozygotes were identical to pooled adult frequencies ( 10%) but frequencies of heterozygotes were less ( 58% versus 90%) while frequencies of BB homozygotes were much greater BB ( 32% versus 0%, Table 3, Figure 2). Removal of the BB genotype from the larval data set brings the pooled larval heterozygote frequency ( 0.85) in line with the pooled adult frequency ( 0.90) ( Table 3). Allele frequencies were significantly different between larvae and adults ( ANOVA; p = 0.00001 for the A allele). After the removal of the larval BB genotypes, frequencies for the A allele between these life stages were no longer significant ( ANOVA; p = 0.2048 between adults and larvae). Removal of larval BB genotypes from other sub- areas produced similar results ( appendix 2A). SNS juvenile suckers from Upper Klamath Lake also had BB homozygotes. The A allele frequencies between juveniles and adults were significantly different ( ANOVA; p = 0.00001). Again, removal of the BB genotypes brought genotypic and allelic frequencies of juveniles in line with pooled SNS adults ( Table 3). The frequency of allele A was no longer significantly different ( ANOVA; p = 0.1 057). Collagen 1 Basin wide genotypic frequencies were similar between larvae and adults of Klamath Basin suckers with a preponderance of AA homozygotes in adults ( 0.74) and larvae ( 0.69) ( Table 3). Allelic frequencies were also nearly identical ( Table 3, ANOVA; p = 0.5603 based on a comparison of the A allele frequency). After removal of the BB genotypes for Ankyrinc, allelic frequencies remained not significantly different ( ANOVA; p= 0.2486). Allele A frequencies were significantly different between SNS juveniles from Upper Klamath Lake and adults ( ANOVA; p = 0.0219) but are similar after removal of Ankyrin~ B B genotypes ( Table 3; ANOVA; p = 0.3499 for the A allele frequency comparison between juveniles and adults). Aldehvde dehvdronenase Genotypic frequencies were identical between larvae and adults of Klamath Basin suckers with a preponderance of AA homozygotes in both ( 0.57) ( Table 3). Allelic frequencies were also identical ( Table 3; ANOVA; p = 0.6370 for the A allele). After removal of the BB genotypes for Ankyrinc, allelic frequencies remained not significantly different ( ANOVA; p= 0.9205). SNS juveniles from Upper Klamath Lake are similar to adult SNS before removal of BB genotypes ( ANOVA; p = 0.331 6 for the A allele) and after removal of the AnkyrinG BB genotypes ( Table 3; ANOVA; p = 0.3872 for the A allele). Population- level analvses Because population phenomena can not be analyzed across species we restricted the data set to four single- species analyses: KLS, upper Williamson River at Rocky Ford; KLS, Sycan River; KLS, Gerber Reservoir/ Barnes Valley Creek; and SNS, Upper Klamath Lake. The first three data sets were adult- larval comparisons and the fourth was an adult-juvenile comparison. A Hardy- Weinberg exact probability test of genotypic frequencies from different life stages showed that different life stage populations for Collagen 1 and Aldehyde dehydrogenase had a high probability of being in HWE ( Table 2). In contrast, AnkyrinG genotypes were not in HWE except in the Sycan River and the coefficients were highly significant ( Table 2). Comparisons of allelic frequencies between life stages indicated that Collagen 1 and Aldehyde dehydrogenase were not significantly different in seven of eight comparisons ( Table 5). The exception was Collagen 1 in SNS from Klamath Lake where the adult population was fixed for the AA genotype. Allelic frequencies were significantly different between life stages for AnkyrinG except for Gerber Reservoir KLS ( Table 5). When data were reanalyzed after removal of individuals that were AnkyrinG BB homozygotes, results were more uniform across loci ( Table 6). Aldehyde dehydrogenase allelic frequencies either did not change or changed by 1 % and there were still no significant differences between life stages. Collagen 1 allelic frequencies changed 2- 4% and there were still no significant differences between life stages except for juvenile SNS from Upper Klamath Lake ( Table 6). AnkyrinG allelic frequencies changed 8- 26% in larvae and juveniles ( Table 6) and changed all comparisons with adults to not significantly different. DISCUSSION Two of the three loci examined, Collagen 1 and Aldehyde dehydrogenase, were generally similar in genotype and allelic frequencies between young and older life history stages ( Table 3). However, all four species of adult suckers were missing the BB genotype of Ankyrin~ w hile larvae had 32% and juveniles 50% BB genotypes ( Table 3). importance of the A allele was found in outgroups where we have found at least one copy of the A allele in all suckers examined to date ( Wagman and Markle, 2000). The AnkyrinG system in Klamath Basin suckers may be similar to the heterozygous advantage seen in the thalassemic disease, human sickle cell anemia ( Livingstone, 1960, 1989). Populations with a heterozygous advantage will not be in HWE even when one allele is lethal in the homozygote state because stabilizing selection maintains overdominant alleles, as seen in the sickle cell example ( Hartl and Clark, 1997). Without stabilizing selection the lethal allele is quickly reduced from the gene pool. Heterozygote advantages appear in many groups ( Pinus ponderosa; Farris and Mitton, 1984; Bufo boreas; Samollow and Soule, 1992; HLA class II type infection of Hepatitis B, Thursz, 1997; Pleuronectes platessa, Beardmore and Ward, 1977; Pigeons; Frelinger, 1972'; Dendragapus obscurus; Redfield 1974; Colias sp., Watt, 1977; Crasssostrea virginica; Singh and Zouros, 1978 and Zouros et al, 1980). AnkyrinG is part of a multi- genic family exhibiting multiple splice variants ( Kordeli et al., 1995). The polymorphism in Klamath Basin suckers ( allele B) is in the extended tail region of the molecule ( Figure I), the region modified in splice variants. The transversion found in allele B is in a sequence that could be involved in a splicing donor site ( Lewin, 1983) or be linked to a downstream ( 3') mutation within the open reading frame ( Table 1). The AnkyrinG molecule is localized in nervous tissue and is associated with a voltage-dependent sodium channel at the nodes of Ranvier ( Kordeli et al., 1995). Sodium is exchanged for NH4' and H+ at the gills ( Moyle and Cech, 1988) and environmental changes in ammonia and pH could be related to the function of the AnkyrinG alleles. Upper Klamath Lake experiences high, potentially lethal, levels of un- ionized ammonia and pH during summer ( Kann and Smith, 1999). The juvenile SNS used in this study were collected in 1997 after very high un- ionized ammonia levels had been reached and at least one Ankyri* BB juvenile had over- wintered ( the largest, 71 mm, caught at Rose Andersen Dam on the Lost River, April, 1997). Water quality conditions are a logical link to the dynamics of Ankyrin~ in Klamath Basin suckers. Conditions responsible for the selection against the BB genotype and selection for the AB genotype may differ but the conditions may be unique to the Rogue and Klamath basins since the B allele has not been found outside the basins ( Wagman and Markle, 2000). Understanding the stabilizing selection for the Ankyrik B allele may be important in conservation and recovery of endangered suckers because it represents a previously unsuspected source of significant early life history mortality. The success or failure of a fish year class is usually attributed to factors such as starvation, predation, or dispersion to unfavorable habitats in the first year of life ( Houde, 1987, 1989, Bailey and Houde, 1989, Sinclair, 1988). The endangered lacustrine suckers are long lived (> 30 y) and highly fecund ( up to 57,000 eggslyr. in female SNS and 235,000 eggslyr. in LRS) ( Scoppettone and Vinyard, 1991), so year class failure is to be expected. However, we know of no case where early life history mortality in a fish has been attributed to a naturally occurring lethal homozygous genotype. Current efforts to monitor year class strength are based on juvenile sampling in early fall when fish are 60- 120 mm FL. Thus, the timing of mortality of the BB genotype has an important bearing on interpretation of year class monitoring efforts. Acknowledgments This study is funded by U. S. Bureau of Reclamation agreement 4- FC- 20- 11810 and USGS, BRD 1434- HQ- 97- RU- 01584, RWO # 9. This is contribution no. XXXXX to the Oregon Agriculture Experiment Station. LITERATURE CITED Allendorf, F. W., Thorgaard, G. H. 1984. Tetraploidy and the Evolution of Salmonid Fishes. In: Evolutionary Genetics of Fishes. Ed. B. J. Turner. Plenum press. New York and London. Applied Biosystems, Inc. SeqEd. Version 1.0.1. 1991. Bailey, K. M. and E. D. Houde, 1989. Predation on eggs and larvae of marine fishes and the recruitment problem. Adv. Mar. Biol., 251- 83. Beardmore, J. A., Ward, R. D. 1977. Polymorphism, selection, and multi- locus heterozygosity in the plaice, Pleuronectes platessa. L. Lect. Notes Biomath. 19: 207- 221. Bennett, V., 1992. Ankyrins: Adapters between diverse plasma membrane proteins and the cytoplasm. The Journal of Biological Chemistry. Vol. 267, No. 13. Pp. 8703- 8706 Chan, W., Kordeli, E., Bennett, V. 1993. 440- kD Ankyrin~ S: tructure of the major developmentally regulated domain and selective localization in Unmyelinated Axons. J. Cell Biol. l23( 6): 1463- 1473. Dawson, G. W. P., 1962. An introduction to the cvtogenetics of polyploids. Blackwell Scientific Publications, Oxford. Farris, M. A., Mitton, J. B. 1984. Population density, outcrossing, and heterozygote superiority in Ponderosa pine. Evolution. 38( 5): 1151- 1154. Ferris, S. D. 1984. Tetraploidy and the Evolution of the Catostomid Fishes. In: Evolutionary Genetics of Fishes. Ed. B. J. Turner. Plenum press. New York and London. Ferris, S. D., Whitt, G. S, 1978. Phylogeny of tetraploid catostomid fishes based on the loss of duplicate gene expression. Syst. Zool. 27: 189- 206. Frelinger, J. A. 1972. The maintenance of transferrin polymorphism in pigeons. Proceedings of the National Academy of Science. USA 69: 326- 329 Glenn, T. 1996. March 22. Step by Step SSCP. Laboratory of Molecular Systematics. Smithsonian Institution, Washington, D. C. 20560. Hartl, D. L., Clark, A. G. 1997. Principles of Population Genetics. 3d edition. . Sinauer Associates, Inc. Massachusetts. Houde, E. D., 1987. Fish early life dynamics and recruitment variability. Am. Fish. Soc. Symposium, 2: 17- 29. Houde, E. D. 1989. Comparative growth, mortality, and energetics of marine fish larvae: temperature and implied latitudinal effects. Fish. Bull. U. S., 87: 471- 495. Kann, J., V. H. Smith. 1999. Estimating the probability of exceeding elevated pH values critical to fish populations in a hypereutrophic lake. Can. J. Fish. Aquat Sci. 56: 2262- 2270. Kordeli, E., Lambert, S., Bennett, V. 1995. AnkyrinG A new ankryin gene with neural-specific isoforms localized at the axonal initial segment and node of Ranvier. J. Biol. Chem. 270 ( 5), 2352- 2359. Kunimoto, M., Otto, E., Bennett, V. 1991. A new 440- kD isoform is the major ankyrin in neonatal rat brain. J. Cell Biol. 11 5( 5): 131 9- 1 331. Lambert, S., Bennett, V. 1993. Postmitotic expression of AnkyrinR and B~ Spectrinin discrete neuronal populations of rat brain. J. Neurosci. 13( 9): 3725- 3735. Lewin, B. ed. 1982. Genes. Second edition. John Wiley and Sons. New York. Livingstone, F. B. 1960. The wave of advance of an advantageous gene: The sickle cell gene in Liberia. Human Biology. 32: 197- 202. Livingstone, F. B. 1989. Update to " The wave of advance of an advantageous gene: The sickle cell gene in Liberia". Human Biology. 61: 831- 834. Marklund, S., Chaudhary, R., Marklund L., Sandberg, K., Andersson, L. 1995. Extensive mtDNA diversity in horses revealed by PCR- SSCP analysis. Animal Genetics. 26, 193- 196. Miller, R. R., Smith, G. R. 1981. Distribution and evolution of Chasmistes ( Pisces: Catostomidae) in western North America. Occasional papers of the Museum of Zoology, University of Michigan, Ann Arbor. 696: l- 46. Moyle, P. B., J. J. Cech. 1988. Fishes, an introduction to Ichthyology. 2" edition. Prentice Hall, New Jersey. National Bioscience, Inc. Oligo. Version 4.0 Plymouth, MN. Redfield, J. A. 1974. Genetics and selection at the Ng locus in blue grouse ( Dendragapus obscurus). Heredity 33: 69- 78. Ronfort, J., Jenczewski, E., Bataillon, T., Rousset, F. 1998. Analysis of Population structure in autotetraploid species. Genetics. 150: 921- 930. October. Samollow, P. B., Soule', M. E. 1982. A case of stress related heterozygote superiority in nature. Evolution. 37( 3): 646- 649. Sinclair, M. 1988. Marine populations, an essay on population regulation and speciation. Univ. Washington Press, 252 p. Scoppettone, G. G. and G. Vinyard, 1991. Life history and management of four endangered lacustrine suckers, pp. 359- 377. IN W. L. Minckley and J. E. Deacon, eds. Battle against extinction, native fish management in the American West. Univ. Arizona Press, Tucson, AZ, 51 7 p. Simon, D., M. Terwilliger, P. Murtaugh, D. F. Markle. 2000. Larval and Juvenile ecology of Upper Klamath Lake suckers. Submitted to Klamath Project, U. S. Bureau of Reclamation, Klamath Falls, Oregon. Singh, S. M., Zouros, E. 1978. Genetic variation associated with growth rate in American oyster ( Crassostrea virginica). Evolution. 32: 342- 353. Taggard, J. B., Hynes, R. A., Prodohl, P. A., Ferguson, A. 1992. A simplified protocol for routine total DNA isolation from salmonid fishes. Journal of Fish Biology. 40: 963- 965. Thursz, M. R., Thomas, H. C., Greenwood, B. M., Hill, A. V. S. 1997. Heterozygote advantage for HLA class- ll type in hepatitis B virus infection. Nature Genetics. 17: 11- 1 2. Tsoi, S. C. M., Sin- Che Lee, Wei- chung Chaos. 1989. Duplicate gene expression and diploidization in an Asian tetraploid Catostomid, Myxocyprinus asiaticus ( Cypriniformes, Catostomidae). Comp. Biochem. Phvsiol. Vol. 93B, No. 1. pp. 27- 32. United States Fish and Wildlife Service. 1988. Endangered and threatened wildlife and plants; determination of endangered status for the shortnose sucker and Lost River sucker. Final rule. Federal Register 53 ( 1 37): 271 30- 271 34. United States Fish and Wildlife Service 1993. Lost River ( Deltistes luxatus) and shortnose ( Chasmistes brevirostris) sucker recovery plan. Portland, Oregon, 36 pp. Uyeno, T. and Smith G. R. 1972. Tetraploid origin of the karyotype of catostomid fishes. Science. 1 75, 644- 646. Wagman, D. W. in preparation. Perfect gels and staining. Wagman, D. W., Markle, D. F., 1999. Ecology of Upper Klamath Lake shortnose and lost river suckers: 5. Molecular evolution and ecology of Klamath Basin suckers. Annual report ( partial) submitted to U. S. Biological Resources Division, US Geological Survey, 104 Nash Hall, Oregon State University, Corvallis, Oregon 97331- 3803. Klamath Project, U. S. Bureau of Reclamation, 6600 Washburn Way, Klamath Falls, OR 97603 Watt, W. B. 1977. Adaptation at specific loci. I. Natural selection on phosphoglucose isomerase of Colias butterflies: biochemical and population aspects. Genetics. 87: 177- 194. Willis, C. 1978. Rank- order selection is capable of maintaining all genetic polymorphisms. Genetics. 89: 403- 41 7. Zouros, E., Singh, S. M, Miles, H. E. 1980. Growth rate in oyster: an overdominant phenotype and its possible explanations. Evolution. 34: 856- 867. Table 1. Ankyrik clone sequence ( 535bp), bold, smallcase areas are primers, underlined area is Ankyrik open reading frame; c * is the site of the transversion. CTGTccagtcctgggaccataccatATGTTGCAGGACTTCTTCTATTCTATT CTATTTGCACAAGGAATGTTTGGATGAAAAATAAATAATCCATGAGTCTTTAT CAATTACAAAAGAMAAATATTCCTCACTCCTTTTATCCA TTCATTAGATTTTTGTGACAGGGGAAATCTAAAATCGATACTTCCCACTGACA CACTTAAGATGAAGATATAAAATAACCAGTTTAAGAGAAAGA CACATTTATTGTGCCGAAAACGTTTGCACAGTTCAATGCACAAATCTCTCTG * AAACCTTAATTATCTTTGCTTGACCAGAAAAGGGCAATCTGCTGCATTAGTTT Table 2: Comparison of genotypic frequencies between life stages at four sites. p values are from a Hardy- Weinberg exact probability test and estimate the probability that a population is in Hardy- Weinberg equilibrium. Site Life stage n Genotype AnkyrinG Collagen Aldehyde 1 dehydrogenase Sycan River Larvae 40 AA 0.075 0.41 0.53 AB 0.575 0.55 0.40 BB 0.35 0.04 0.07 P 0.1807 0.1263 1 . O Adults 7 AA 0.14 0.43 0.43 AB 0.86 0.43 0.57 BB 0 0.14 0 P 0.1 608 1. O I. O Rocky Ford Larvae 22 AA 0 0.59 0.82 AB 0.55 0.41 0.1 8 BB 0.45 0 0 P 0.1432 0.5381 1 . O Adults 19 AA 0.05 0.74 0.89 AB 0.95 0.21 0.1 1 BB 0 0.05 0 P 0.0002* 0.371 1 . O Upper Juveniles 69 AA 0.02 0.78 0.78 Klamath Lake Adults 27 AA 0.07 1 . O 0.74 AB 0.93 0 0.22 BB 0 0 0 P O. OOOO* NA 0.4538 Gerber Larvae 22 AA 0.04 0.59 0.64 Reservoir AB 0.82 0.36 0.32 BB 0.14 0.05 0.04 P 0.0075" 1 . O 1 . O Adults 21 AA 0.10 0.86 0.71 AB 0.90 0.14 0.29 BB 0 0 0 P 0.0003* 1 . O 1 . O Table 3. Pooled genotypic, and allelic data for all adults, SNS juveniles and larvae for AnkyrinG, Collagen 1 and Aldehyde dehydrogenase loci before and after removal of AnkyrinG BB genotypes. Life n Species AA AB BB FreqA Freq B stage AnkyrinG- With AnkyrinG BB genotypes Adults 119 SNS 0.13 0.87 0 Adults 45 KLS 0.04 0.96 0 Adults 47 KSS 0.02 0.98 0 Adults 31 LRS 0.23 0.77 0 Adults 242 all adults 0.1 0.9 0 Larvae 325 Larvae 0.1 0.58 0.32 Juveniles 69 SNS 0.01 0.49 0.5 AnkyrinG- Without AnkyrinG BB genotypes Larvae 221 Larvae 0.15 0.85 0 Juveniles 36 SNS 0.03 0.97 0 Collagen I- With AnkyrinG BB genotypes Adult 119 SNS 0.91 0.08 0.01 Adult 45 KLS 0.71 0.2 0.09 Adult 47 KSS 0.15 0.06 0.79 Adult 31 LRS 0.97 0.03 0 Adult 242 Total 0.74 0.09 0.17 Larvae 325 Larvae 0.69 0.22 0.09 Juvenile 69 SNS 0.78 0.22 0 Collagen 1- Without AnkyrinG BB genotypes Larvae 221 Larvae 0.72 0.2 0.08 Juvenile 38 SNS 0.84 0.16 0 -- Aldehyde Dehydrogenase- With AnkyrinG BB genotypes Adult 119 SNS 0.73 0.25 0.02 0.86 0.14 Adult 45 KLS 0.73 0.27 0 0.87 0.13 Adult 47 KSS 0.02 0.47 0.51 0.26 0.74 Adult 31 LRS 0.58 0.29 0.13 0.73 0.27 Adult 242 Total 0.57 0.3 0.13 0.73 0.27 Larvae 325 Larvae 0.57 0.29 0.14 0.71 0.29 Juvenile 69 SNS 0.78 0.22 0 0.89 0.1 1 Aldehyde Dehydrogenase- Without AnkyrinG BB genotypes Larvae 221 Larvae 0.58 0.28 0.13 0.73 0.27 Juvenile 38 SNS 0.76 0.24 0 0.88 0.12 Table 4. Position of homology between sucker and human AnkyrinG and comparison of amino acid sequences. Comparison of amino acid sequences ( one- letter code) between sucker and human AnkyrinG molecules. Numbers at the beginning and end of the amino acid sequence represent the corresponding nucleic acid positions. Sucker AnkyrinG---- 480- SGPQSPCERTDLRMAIVA- 533 + + Human Ankyrinc- 4081- TGPQSPCERTD I RMAIVA- 4098 Table 5. Allelic frequency comparisons between life stages at four sites before selection. p values represent the results of an ANOVA testing for frequency differences for the A allele. Site Life stage n Allele AnkyrinG Collagen 1 Aldehyde dehydrogenase Sycan River Larvae 40 A 0.36 0.68 0.73 B 0.64 0.32 0.28 Adults 7 A 0.57 0.64 0.71 B 0.43 0.36 0.29 P 0.008* 0.0866 0.9337 Rocky Ford Larvae 22 A 0.27 0.80 0.91 B 0.73 0.20 0.09 Adults 19 A 0.53 0.84 0.95 B 0.47 0.1 6 0.05 P 0.003" 0.5851 0.501 5 Upper Klamath Lake Juveniles 69 A 0.25 0.89 0.89 Adults 27 A 0.54 1 . O 0.85 B 0.46 0 0.1 5 P O. OOOO* 0.008* 0.4457 Gerber Reservoir Larvae 21 A 0.45 0.77 0.80 Adults 21 A 0.55 0.93 0.86 B 0.45 0.07 0.14 P 0.1 873 0.0676 0.5637 Table 6 : Allelic frequency comparisons between life stages at four sites after removal of the AnkyrinG BB individuals from the larval data. p values represent the results of an ANOVA testing for frequency differences for the A allele. Site Life n Allele AIIkyrinG Collagen I Aldehyde stage dehydrogenase Sycan River Larvae 26 A 0.56 0.71 0.73 B 0.44 0.29 0.27 Adults 7 A 0.57 0.64 0.71 B 0.43 0.36 0.29 P 0.8492 0.6044 0.9096 Rockv Ford Larvae 12 A 0.50 0.80 0.91 Adults 19 A 0.53 0.84 0.95 B 0.47 0.1 6 0.05 P 0.4361 0.38 0.301 6 Upper Klamath Lake Juveniles 34 A 0.51 0.91 0.90 Adults 27 A 0.54 1 . O 0.85 B 0.46 0 0.1 5 P 0.431 4 0.021 3* 0.461 1 Gerber Reservoir Larvae 19 A 0.53 0.81 0.81 B 0.47 0.19 0.1 9 Adults 21 A 0.55 0.93 0.86 B 0.45 0.07 0.14 P 0.6202 0.0822 0.4301 AnkyrinG Molecule 480 kDa structure Rllembrane \ / nSeri ne Rich C- Terminal Bindina Spectrin I/-= m I / -- Extended Tail Figure 1. AnkyrinG molecule ( Kordeli et al., 1995) re- printed with permission from the author and journal. Adults Juveniles Larvae Genotypes Figure 2. Genotypic frequencies of Klamath basin adults, SNS juveniles and larvae. Allele A Allele B Figure 3. SSCP profile of genotypes of Klamath basin suckers. HiLo are size markers. Appendix 1 : Larval and juvenile suckers used in this study. Samples are listed by drainage, site, latitude and longitude, site code, individual number, Capture date, Developmental stage, and Total Length ( mm). Sprague River, Pole Creek: ~ 4 22' 1 . I 56',~ 121' 02.1 00' Sprague River, between Beatty ant SP2- 1 1,511 3197, PML, 14 1 Bly: Nd Sprague River, Mile Marker 12: ~ 4 23' 3 .61',~ 1213~ 8 .92' SP7- 1,511 4/ 97, PML, 15 13,511 4/ 97, PML, 18 2,5114197, PML, 15 14,511 4/ 97, PML, 15 3,5114197, ML, 18 15, 5/ 14/ 97, ML, 21 4,5114197, ML, 18 16,5114197, ML, 18 5, 5/ 14/ 97, ML, 19 17,5/ 14197, ML, 1 9 6,5114197, ML, 20 18,5/ 14/ 97, PML, 16 7, 511 4/ 97, PML, 13 20,5/ 14/ 97, ML, 21 8,5114197, ML, 17 21,5/ 14/ 97, ML, 25 9,5114197, PML, 14 22,5/ 14197, ML, 21 10,5114197, ML, 23.5 23,5/ 14/ 97, ML, 21 1 1,5114197, ML, 1 8 24,5/ 14197, PML, 12 12,5114197, ML, 17 Sycan River, Drews Road: ~ 4 22' 9 .1 5',~ 12' 1 16 .77+ H6SW SYI- 1,5114196, FML, 15 13, 6/ 19/ 96, FML, 13.5 2, 511 4196, FML, 16 15, 6/ 19/ 96, FML, 13.5 3,5114196, FML, 13 16,611 9/ 96, FML, 13 5, 5/ 14/ 96, FML, 13 19, 5/ 14/ 96, FML, 14 7, 5/ 14/ 96, FML, 12.5 20, 5/ 14/ 96, FML, 13 8,5114196, FML, 13 21,5114196, FML, 13 9,5114196, FML, 13.5 22, 5114196, FML, 9 1 1,5114196, PFML, 16 30,6119196, PFM, 14.0 31,5/ 14/ 97, PFM, 14.0 32,5114197, PFM, 13.5 33,5114197, PFM, 14.0 34,5114197, PFM, 14.0 35,5114197, PFM, 13.0 47,5114197, PFM, 14.0 48,5114197, PFM, 13.5 50,5114197, PFM, 13.0 51,5114197, PFM, 14.0 52,5114197, PFM, 14.0 53,5114197, PFM, 15.0 54,5114197, PFM, 12.0 55,5114197, PFM, 14.0 56, 5/ 14/ 97, PFM, 14.0 57, 5/ 14/ 97, PFM, 13.5 58,5114197, PFM, 13.0 61,614197, PFM, 14.0 63,614197, PFM, 14.0 67,614197, PFM, 12.5 72,614197, ML, 19.0 73,614197, PFM, 15.5 76,614197, PFM, 14.0 77,614197, ML, 24.0 79,614197, PFM, 12.0 Williamson River, Rocky Ford: ~ 4 25' 3 .679', w121° 27.821' WLI- 13,612197, FM, 13.0 27,612197, FM, 13.0 14,612197, FM, 13.0 28,612197, FM, 14.0 15,612197, FM, 12.0 31,612197, FM, 12.0 46,612197, PFM, 12.0 33,612197, FM, 12.0 18,612197, FM, 12.5 34,612197, FM, 13.0 19, 612197, FM, 1 1.5 35,612197, FM, 10.0 20,612197, FM, 12.0 36,612197, PFM, 15.5 21,612197, FM, 12.0 37,612197, PFM, 14.0 22,612197, FM, 13.0 38,612197, PFM, 14.0 24,612197, FM, 12.0 40,6119196, PFM, 14.5 26,612197, PFM, 15.5 44, 611 9196, ML, 17.0 Williamson River, Kirk Bridge: ~ 4 24' 4 .914',~ 1214~ 9. 967' WL3- 14,612197, PF, 12.5 26, 612197, PF, l 7 15,612197, PF, 18 27,6/ 2197, PF, 16 16,612197, PF, 14 29, 612197, ML, 1 7 17,612197, PF, 12 30,6/ 2197, PFML, 15 18,612197, PF, 17 31,6/ 2197, PFML, 15 19,612197, PF, 15 32,6/ 2197, ML, l 8 21,612197, PF, 18 33,6/ 2197, PFML, 15 22,612197, PF, 17.5 34,6/ 2197, ML, l 9 23,612197, PF, 17 35,6/ 2197, PFML, 14 24,612197, PF, 14 36,6/ 2197, ML, 18 25, 6/ 2/ 97, PF, 17 38,6/ 2197, ML, l 9 Williamson River, Chiloquin boat ramp: ~ 4 23' 4.25',~ 1215~ 2. 74' WL2- Upper Klamath Lake, Silver Building Spring: ~ 4 22' 3 .55',~ 12149~. 17' U2- 1,5/ 14196, PL, 15 15,511 6/ 97, PL, 1 0 2,511 4/ 96, PL, 14 16,5/ 16/ 97, PL, 9.5 5,511 4/ 96, PL, 12 17,511 6/ 97, PL, 10 6,511 6/ 97, PL, I 2 18,511 6/ 97, PL, 10.5 7,5/ 16/ 97, PL, 13 20,511 6/ 97, PL, 9 9,5/ 16/ 97, PL, 13 21,5/ 16/ 97, PL, 11 1 1,511 6/ 97, PL, 14 22,5/ 16/ 97, PL, 1 1 12,5/ 16/ 97, PL, 13.5 23,511 6197, PL, l 1 13,5/ 16/ 97, PL, 11 24,511 6/ 97, PL, 1 0 l4,5/ l6/ 97, PL, lO Upper Klamath Lake, Ouxy Spring: ~ 4 22' 3 .93', w121° 49.41' U3- 2,511 5197, PL, 12 1 1,511 5197, PL, 13.5 3,511 5/ 97, PL, 13 12,511 5/ 97, PL, 13 4,511 5/ 97, PL, 13 13,511 5/ 97, PL, l3 5,511 5/ 97, PL, 12.5 14,511 5/ 97, PL, 13.5 6,511 5/ 97, PL, 12.5 15,511 5/ 97, PL, 13.5 7,511 5/ 97, PL, 13.5 16,511 5197, PL, 12.5 8,5/ 15/ 97, PL, 14 17,511 5/ 97, PL, l 2.8 9,511 5/ 97, PL, 14 18,5/ 15/ 97, PL, 13 10,511 5/ 97, PL, 13 19,511 5/ 97, PL, 12.5 Upper Klamath Lake, Stone House: ~ 4 21' 5 .28', w121° 50.49' UKSH- 1,5/ 21/ 97, ML, 18 8,5/ 21/ 97, ML, 20 2,5121 / 97, ML, 20 9,5/ 21197, ML, 18 3,5/ 21/ 97, ML, 19 11,5/ 21/ 97, PML, 14 4,5/ 21/ 97, PML, 14 12,5/ 21/ 97, PML, 15 5,5/ 21/ 97, PML, 18 13,5/ 21/ 97, PML, l6 6,5/ 21/ 97, PML, 1 5 14,5/ 21/ 97, PML, 17 7,5/ 21/ 97, PML, 14 Samples are listed by Field number: Upper Klamath Lake: Juveniles: Chasmistes brevirostris: Lost River, Rose- Andersen Dam: ~ 4 20' 0 .454',~ 121' 31.765' L1- 2J, 4122/ 97, Juvenile, 67 4J, 4/ 22/ 97, Juvenile, 71 Lost River, Below Harpold Dam: ~ 4 21' 0 .201',~ 121 27.19 ' L3B- 10,511 3/ 97, PML, 14 2a, 5/ 15/ 96, NoData, l6 1 1,5/ 13197, PML, 12 3a, 5/ 15/ 96, ND, 1 3 12,5/ 13/ 97, PML, 13 3b, 5/ 13/ 97, ND, 15 13,511 3/ 97, PML, 14 4a, 5/ 15/ 96, ND, 14 14,5/ 13/ 97, ML, 15 4b, 5/ 13/ 97, ND, 12 16,511 3197, PML, 12 5a, 5/ 15/ 96, ND, 13 17,5/ 13/ 97, PML, 14 6a, 5/ 15/ 96, ND, 15 20,511 3/ 97, PML, l3 7a, 5/ 15/ 96, ND, 14 21,511 3/ 97, PML, 13 7b, 5/ 13/ 97, ND, 14 23,5/ 13/ 97, PML, 13 8a, 5/ 15/ 96, ND, 16 Lost River, Above Harpold Dam: ~ 4 21' 0 .201',~ 12' 1 27.19 ' L3A- 1,6/ 19/ 96, ML, 16 14,6/ 19/ 96, PML, 13 2,611 9/ 96, ML, 15.5 15,611 9/ 96, ML, 19 3,611 9196, ML, 16 16,611 9196, ML, 15 10,6/ 19196, ML, 15 17,6/ 19196, ML, 16 11,6/ 19/ 96, ML, 18 18,611 9/ 96, PML, 15 12,611 9196, PML, 13 19,6/ 19/ 96, PML, 13 13,611 9/ 96, PML, 15 Lost River, Bonanza, outside of Big Springs: ~ 4 2I' 1 . ~ SO', WI~ 2I3~. 9 16' L2- Lost River, Barnes Valley Creek: ~ 4 2I'O .~', WI~ I ' 03.9' GI - 13,5/ 14196, FML, 11.5 26,5/ 14196, FML, 1 3 15,5/ 14/ 96, FML, 13 27,5/ 14196, FML, 12 16,511 4/ 96, FML, 13 29,5/ 14/ 96, FML, 1 3 17,5/ 14196, FML, 12.5 30,5/ 14/ 96, FML, 1 3 18,5/ 14/ 96, FML, 1 3 33,5/ 14196, FML, 12.5 19,5/ 14/ 96, FML, 1 3.5 35,5/ 14/ 96, FML, 13 21,5114/ 96, FML, 12.5 37,5/ 14/ 96, FML, 1 3 22,5/ 14/ 96, FML, 12.5 38,5/ 14196, FML, 13 23,5/ 14/ 96, FML, l4 39,5114196, FML, 12.5 24,5/ 14/ 96, FML, 14 40,5/ 14/ 96, FML, 13 25,5/ 15/ 96, FML, 13 42,5/ 14/ 96, FML, 13 Lower Klamath River, Spencer Creek: N420 09.081', W1220 0.698' LK2- 1 ,6/ 5/ 97, PML, 17 14,6/ 5/ 97, PML11 3 2,6/ 5/ 97, PML, I 3 15,6/ 5/ 97, PML, I 5 3,6/ 5/ 97, PML, I 3 1 6,6/ 5/ 97, PML, I 5 4,6/ 5/ 97, PML, 14 17 ,6/ 5/ 97, PML114 .5 6,6/ 5/ 97, PMLY14 1 8,6/ 5/ 97, PML, 14 9,6/ 5/ 97, PML, I 5 1 9,6/ 5/ 97, PML, 15 I 0,6/ 5/ 97, PML, 14 20,6/ 5/ 97, PML, I 6 11,6/ 5/ 97, PML, 15 21,6/ 5/ 97, PML, I 6 12,6/ 5/ 97, PML, l8 23,6/ 5/ 97, PML, I 6 1 3,6/ 5/ 97, PML, I 8 24,6/ 5/ 97, PML, I 5 Lower Klamath River, Jenny Creek: N420 07.106', W1220 21.976' LK1 - 8,6/ 20/ 96, PL, 13 9,6/ 20/ 96, PL, I 6.5 10,6/ 20/ 96, PL, 14 11,6/ 20/ 96, PL, 16 12,6/ 20/ 96, PL, I 7 14,6/ 20/ 96, PL, I 5 15,6/ 20/ 96, PL, 17 1 6,6/ 20/ 96, PLyl 6 18,6/ 20/ 96, PL, I 9 1 9,6/ 20/ 96, PL, 14 21 ,6/ 20/ 96, PL, I 5 23,6/ 20/ 96, PL, 14 24,6/ 20/ 96, PL, 1 Appendix 2: Genotypic and allelic frequencies for all life stages, identified species and sites. A) Ankyrim, B) Collagen 1, C) Aldehyde dehydrogenase A) AnkyrinG genotypic and allelic frequencies by species, life stage and site. Selection is simulated by removal of the BB genotype individuals from the larval data set. With AnkyrinGB B genotypes Without Ankyrin~ B B genotypes Species site n AA AB BB Freq A Freq B n AA AB Freq A Freq B SNS all 119 0.13 0.87 0 0.56 0.44 KLS all 45 0.04 0.96 0 0.52 0.48 KSS all 47 0.02 0.98 0 0.51 0.49 LRS all 31 0.23 0.77 0 0.61 0.39 Total all 242 0.10 0.90 0 0.55 0.45 Larvae all 325 0.10 0.58 0.32 0.39 0.61 221 0.15 0.85 0.58 0.42 SNS Sprague 5 0.20 0.8 0 0.60 0.40 KLS Sprague 16 0 1 . O 0 0.50 0.50 LRS Sprague 5 0.20 0.8 0 0.60 0.40 Larvae Pole Creek 21 0.10 0.52 0.38 0.36 0.64 13 0.15 0.85 0.58 0.42 Larvae Mile Marker 12 23 0.09 0.91 0 0.54 0.46 23 0.09 0.91 0.54 0.46 Larvae total 44 0.09 0.73 0.18 0.45 0.55 36 0.1 1 0.89 0.56 0.44 - - KLS Sycan 7 0.14 0.86 0 0.57 0.43 Larvae total 40 0.08 0.58 0.34 0.36 0.64 26 0.12 0.88 0.56 0.44 KLS Rocky Ford 19 0.06 0.94 0 0.53 0.47 Larvae Rocky Ford 22 0 0.55 0.45 0.27 0.73 12 0 1.0 0.50 0.50 Larvae Kirk Bridge 22 0.14 0.32 0.54 0.30 0.70 10 0.30 0.70 0.65 0.35 SNS Lower Williamson 12 0.08 0.92 0 0.54 0.46 KLS Lower Williamson 1 0 1 . O 0 0.50 0.5 LRS Lower Williamson 1 0 1 . O 0 0.50 0.5 Larvae Chiloquin boat 46 0 0.54 0.46 0.27 0.73 25 0 1.0 0.50 0.50 ramp SNS KSS LRS Larvae Larvae Larvae Larvae SNS Upper Klamath 10 Lake ( UKL) UKL 1 UKL 14 Silver Building 19 Spring Ouxy Spring 20 Stone House 13 total 52 Juveniles 69 SNS Gerber 20 0.10 0.90 0 0.55 0.45 KLS Gerber 1 0 1 . O 0 0.50 0.50 Larvae Barnes Valley 22 0.04 0.82 0.14 0.45 0.55 19 0.05 0.95 0.53 0.47 Creek SNS Lost River 1 0 1 . O 0 0.50 0.50 LRS Lost River 3 0 1 . O 0 0.50 0.50 Juveniles Rose Andersen 2 0 0 1 . O 0 1 . O 0 0 0 0 0 Dam Larvae Below Harpold 20 0.05 0.55 0.4 0.33 0.67 12 0.08 0.92 0.54 0.46 Dam Larvae Above Harpold 13 0.92 0.08 0 0.96 0.04 13 0.92 0.08 0.96 0.04 Dam Larvae Big Springs, 9 0.11 0.89 0 0.56 0.44 9 0.11 0.89 0.56 0.44 Bonanza Larvae total 44 0.33 0.47 0.19 0.57 0.43 36 0.39 0.61 0.69 0.31 SNS Clear Lake 62 0.18 0.82 0 0.59 0.41 LRS Clear Lake 8 0.25 0.75 0 0.63 0.37 SNS TOPSY 3 0 1 . O 0 0.50 0.50 KLS TOP~ Y 1 0 1 . O 0 0.50 0.50 KSS TOP~ Y 18 0.06 0.94 0 0.53 0.47 Larvae Spencer Creek 20 0 0.2 0.8 0.1 0.9 4 0 1.0 0.50 0.50 SNS Copco 5 0 1 . O 0 0.50 0.50 Larvae Jenny Creek 13 0 1 . O 0 0.50 0.50 13 0 1.0 0.50 0.50 KSS Rogue River 28 0 1 . O 0 0.50 0.50 SNS Hatchery 1 0 1 . O 0 0.50 0.50 B) Collagen I- Genotypic and allelic frequencies by species and site. Species site ~ - n AA AB BB Freq A Freq B SNS all KLS all KSS all LRS all Total all Larvae all SNS Sprague 5 1 . O 0 0 1 . O KLS Sprague 16 0 1 . O 1 . O 0.91 0.09 LRS Sprague 5 0.80 0.20 0 0.90 0.1 0 Larvae Pole Creek 20 0.75 0.25 0 0.88 0.12 Larvae Mile Marker 12 24 0.83 0.1 7 0 0.92 0.08 Larvae total 44 0.80 0.20 0 0.90 0.1 0 - ~ ~ -- KLS Sycan 7 0.285 0.428 0.285 0.50 0.50 Larvae Drews Road 40 0.45 0.52 0.03 0.71 0.29 KLS Rocky Ford 19 0.74 0.21 0.05 0.84 0.16 Larvae Rocky Ford 21 0.57 0.43 0 0.79 0.21 Larvae Kirk Bridge 22 1 . O 0 0 1 . O 0 SNS Lower Williamson 12 1 . O 0 0 1 . O 0 KLS Lower Williamson 1 1 . O 0 0 1 . O 0 LRS Lower Williamson 1 1 . O 0 0 1 . O 0 Larvae Chiloquin Boat ramp 46 0.87 0.1 3 0 0.93 0.07 SNS Upper Klamath Lake 10 1 . O 0 0 1 . O 0 SNS- Upper Klamath Lake 69 0.78 0.22 0 0.89 0.1 1 Juv KSS Upper Klamath Lake 1 I. O 0 0 1. O 0 LRS Upper Klamath Lake 14 1 . O 0 0 1 . O 0 Larvae Silver Building Spring 19 1 . O 0 0 1 . O 0 Larvae Ouxy Spring 20 1 . O 0 0 1 . O 0 Larvae Stone House 13 0.92 0.08 0 0.96 0.04 SNS Gerber 20 0.85 0.15 0 0.93 0.07 KLS Gerber 1 1 . O 0 0 1 . O Larvae Barnes Valley Creek 22 0.59 0.36 0.05 0.77 0.23 SNS Lost River 1 1 . O 0 0 1 . O 0 LRS Lost River 3 1 . O 0 0 1 . O 0 Larvae Rose Andersen Dam 2 1 . O 0 0 1 . O 0 Larvae Below Harpold 20 0.55 0.40 0.05 0.75 0.25 Larvae Above Harpold 13 1 . O 0 0 1 . O 0 Larvae Big Springs, Bonanza 9 0.67 0.33 0 0.83 0.17 SNS Clear Lake 62 0.90 0.08 0.02 0.94 0.06 LRS Clear Lake 8 1 . O 0 0 1 . O 0 SNS Topsy Reservoir 3 1.0 0 0 1 . O 0 KLS Topsy Reservoir 1 0 1 . O 0 0.50 0.50 KSS Topsy Reservoir 18 0.33 0.17 0.50 0.42 0.58 Larvae Spencer Creek 20 0 0.30 0.70 0.15 0.85 SNS Copco 5 0.80 0.20 0 0.90 0.1 0 Larvae Jenny Creek 13 0 0 1 . O 0 1 . O KSS Rogue River 28 0 0 1 . O 0 1 . O SNS Hatchery 1 1 . O 0 0 1 . O 0 C) Aldehyde dehydrogenase genotypic and allelic frequencies by species and site. Species site Freq A Freq B SNS KLS KSS LRS Total Larvae all all all all all all SNS Sprague 5 0.60 0.20 0.20 0.70 0.30 KLS Sprague 16 0.63 0.37 0 0.81 0.19 LRS Sprague 5 0.40 0.40 0.20 0.60 0.40 Larvae Pole Creek 20 0.35 0.45 0.20 0.58 0.42 Larvae Mile Marker 12 24 0.79 0.21 0 0.90 0.1 0 Larvae total 44 0.58 0.33 0.09 0.74 0.26 KLS Sycan 7 0.43 0.57 0 0.71 0.29 Larvae Drews Road 40 0.52 0.40 0.08 0.73 0.28 KLS Rocky Ford 19 0.89 0.1 1 0 0.95 0.05 Larvae Rocky Ford 22 0.82 0.1 8 0 0.91 0.09 SNS Lower Williamson 12 0.83 0.1 7 0 0.92 0.08 KLS Lower Williamson 1 1 . O 1 . O LRS Lower Williamson 1 1 . O 1 . O Larvae Chiloquin boat ramp 46 0.54 0.43 0.02 0.76 0.24 SNS Upper Klamath Lake I 0 0.70 0.30 0 0.85 0.15 SNS- Upper Klamath Lake 69 0.78 0.22 0 0.89 0.1 1 Juveniles KSS Upper Klamath Lake 1 0 0 1 . O 0 1 . O LRS Upper Klamath Lake 14 0.79 0.14 0.07 0.86 0.14 Larvae Silver Building Spring 19 0.58 0.37 0.05 0.76 0.24 Larvae Ouxy Spring 20 0.45 0.35 0.20 0.63 0.38 Larvae Stone House 13 0.62 0.31 0.07 0.77 0.23 SNS Gerber 20 0.70 0.30 0 0.85 0.15 KLS Gerber 1 1 . O 1 . O Larvae Barnes Valley Creek 22 0.64 0.32 0.04 0.80 0.20 SNS Lost River 1 0 1.0 0 0.50 0.50 LRS Lost River 3 0.33 0.67 0 0.67 0.33 Larvae Rose Andersen Dam 2 0.50 0 0.50 0.50 0.50 Larvae Below Harpold Dam 20 0.60 0.40 0 0.80 0.20 Larvae Above Harpold Dam 13 1 . O 0 0 1.0 0 Larvae Big Springs, Bonanza 9 0.67 0.33 0 0.83 0.1 7 Larvae total 44 0.73 0.25 0.02 0.85 0.1 5 SNS Clear Lake 62 0.79 0.1 9 0.02 0.89 0.1 1 LRS Clear Lake 8 0.375 0.375 0.25 0.56 0.44 SNS Topsy Reservoir 3 0.34 0.66 0 0.67 0.33 KLS Topsy Reservoir 1 1 . O 0 0 1 . O 0 KSS Topsy Reservoir 18 0.06 0.77 0.17 0.44 0.56 Larvae Spencer Creek 20 0 0 1 . O 0 1.0 SNS Copco 5 0.40 0.60 0 0.70 0.30 Larvae Jenny Creek 13 0 0.15 0.85 0.08 0.92 KSS Rogue River 28 0 0.29 0.71 0.14 0.86 SNS Hatchery 1 1 . O 0 0 1