ECOLOGY OF UPPER KLAMATH LAKE SHORTNOSE AND LOST RIVER SUCKERS 5. Molecular evolution and ecology of Klamath Basin suckers A. Use of anonymous nuclear loci as species markers in Klamath Basin suckers ( Catostomidae). 1999 ANNUAL REPORT ( partial) SUBMITTED TO U. S. Biological Resources Division US Geological Survey 104 Nash Hall Oregon State University Corvallis, Oregon 97331 - 3803 & Klamath Project U. S. Bureau of Reclamation 6600 Washburn Way Klamath Falls, OR 97603 BY D. Wolfe Wagman & Douglas F. Markle Oregon Cooperative Research Unit 104 Nash Hall Department of Fisheries and Wildlife Oregon State University Corvallis, Oregon 97331 - 3803 March 10,2000 ABSTRACT We used low copy number anonymous nuclear loci to search for species markers in four Klamath Basin and four outgroup suckers. We recognize four classes of markers: fixed species differences, strictly diagnostic markers, operationally diagnostic markers, and frequency dependent markers. Only the first two can be used independently to identify individuals to species. We examined 28 randomly chosen loci, sequenced 10,421 base pairs, and found no fixed differences in four Klamath Basin species. Genotype 6 of locus 142 was a strictly diagnostic marker for shortnose suckers, but occurred in only 16% of specimens. The homozygous BB genotype of Collagen 1 was an operationally diagnostic marker for Klamath smallscale suckers, but corroboration is currently lacking. The homozygous BB genotype of Aldehyde dehydrogenase was a frequency dependent marker for Klamath smallscale suckers, but, again, corroboration is lacking. Some of the loci, such as Ankyrik, were much better markers for outgroup species than for Klamath Basin suckers and suggest that the technique has power and that the genetic similarity detected in Klamath Basin suckers is not an artifact. The management implications of this and related studies are not yet clear. Because genetic similarity might be a result of hybridization and because hybridization could be a natural and necessary source of genetic variation, it is not currently advisable to make management decisions detrimental to hybrids. INTRODUCTION The goals of this study were: 1) to isolate and characterize genetic species markers for each species of Klamath Basin sucker ( shortnose sucker, (- ( SNS), Chasmistes brevirostris; Lost River sucker, ( LRS), Deltistes luxatus; Klamath largescale sucker ( KLS), Catostomus snyderi; and Klamath smallscale sucker, ( KSS), Ca. rimiculus); 2) to investigate the potential for hybridization; and 3) to examine population structure or relatedness between sucker populations. Unique molecular markers would allow species and hybrid identification for all ontogenetic stages. Various techniques were available for this goal but most had drawbacks. Allozymes have been used to distinguish sucker species ( Buth 1978; Buth et al. 1987, Crabtree and Buth 1987) and to investigate catostomid phylogeny ( Ferris and Whitt 1978). This method requires fresh frozen tissues from several organ systems, multiple developmental stages and is difficult to use on larvae. Mitochondria1 DNA ( mt DNA) analysis could have used the universal primers of Kocher et al. ( 1 989) but because it is maternally inherited it does not, by itself, address the issue of hybridization. Instead, we used low copy number anonymous nuclear loci, a technique previously used to distinguish populations of green turtles ( Karl et al. 1992) and oysters ( Karl and Avise, 1993). The technique begins with a genomic library that is randomly sampled for clones. Clones are amplified for each species using polymerase chain reaction ( PCR), sequenced and aligned to determine variation. METHODS Fish samples Fish used for this study are listed in Appendix 1. Adults from Klamath and Rogue river basins were collected by U. S. Bureau of Reclamation ( BOR) in 1993 and were meant to be representative samples of each species and each known spawning group. BOR collected 333 adult fish and 296 tissue samples were available for this study. Librarv Construction DNA preparation for cloning A genomic library was constructed from a SNS, AR- 041 ( 0s 01 5963- B), captured in the lower Williamson River. DNA was isolated from muscle tissue following the procedure of Taggard et al. ( 1992) with two modifications. DNA was precipitated overnight at - 20 ' C followed by a 4 ' c~ en trifugation for 20 minutes at 13,000 X g and centrifuged again after washing with 70% ethanol. DNA was quantified by spectrophotometry. Total DNA ( 10 ug) was restriction digested with Sau 3AI ( Promega, React 4, 10 X buffer) following the manufacturer's directions. Restricted DNA was size fractionated on a 0.8% agarose gel next to size ladder made from Hind Ill- restricted Lambda Phi X 174 ( Sigma). The electrophoretic agarose gel was visualized on an ultraviolet ( UV) light source and the region between 300- 600 bp was excised. DNA was eluted from using BIO 101 Geneclean protocol and 2.1 ug of restricted DNA was recovered. Vector DNA preparation Plasmid pUC18 ( Promega) was restriction digested with Bam HI ( Promega, React 3, 10 X Buffer). BamHl and Sau3Al have similar restriction sequences and are complimentray. Restricted DNA was extracted with tris saturated phenol ( pH 7.6) and chloroform ( 24: l isopropanol), centrifuged, the aqueous phase collected and precipitated with 111 oth volume of 3M sodium acetate and 2.2 volumes of 99% ethanol for 3 hours at - 7 3 ' ~ DNA was centrifuged for 20 min at 12,000 X g, aspirated and re- suspended in 17 ul water. The vector was de- phosphorylated to prevent recircularization to its self. Dephosphorylation occurred with 2 ul 10 X Calf intestinal phosphase ( CIP) buffer ( Promega) and 1 ul CIP at 37' c for 48 hours. Reaction was precipitated as before and stored at - 73 ' c. Ligation Reaction Ligation of sucker restricted DNA to dephosphorylated pUC 18 vector was accomplished using protocols in Sambrooke et al. ( 1989). Two ligation protocols were used, 1 : I and 1 : 3 ratios of vector arms to insert DNA arms. Each 20- ul reaction contained 25ng or 75 ng of insert DNA, respectively. The reaction also contained 50 ng of dephosphorylated, BamHl restriction digested pUC 18 DNA, 4 ul of 5 X Ligation Buffer ( Promega), 1 unit of T4 Ligase ( Promega), and water. pUC 18 DNA and sucker restricted DNA ( insert DNA) were combined, incubated for 3.5 minutes at 48 OC, and placed on ice. Buffer and enzyme were then added and incubated for 3.5 hours at room temperature ( R. T.). The ligation reaction was diluted with 30 ul of water and mixed with 200 ul of competent DH5a E. coli . Transformation was accomplished by incubating the mixture for 30 minutes on ice, followed by a 3 minute 43 OC heat shock. Luria Broth ( LB) ( 1 ml) was added and the mixture incubated for 1 hr at 37 OC with shaking at 200 rpm. LB ampicillin ( 100mm) plates were prepared with 4 ul IPTG ( 200 mgl ml) and 40 ul X- Gal ( 20 mgl ml) for blue- white color determination. The two ligation libraries were then plated in densities of 10,25 and 100 ul per plate. Plates were inverted and incubated at 37 OC overnight. Each ligation library ( 500 ul) was mixed with an equal volume of sterile glycerol and frozen at - 73 OC. The I : I and 1 : 3 libraries were approximately 50 % recombinant and contained an estimated 412 and 2012 recombinant clones, respectively. Clones were haphazardly chosen and grown for DNA isolation. Clone DNA isolation We picked 202 recombinant clones and each was grown in 4.5 ml of ampicillin inoculated LB at 3 7 ' ~ o vernight at 250 rpm. In the morning, 500 ul of each culture was aliquoted and mixed with an equal volume of sterile glycerol and stored at - 73 OC for archival purposes. Cultures were centrifuged at 12,000 X g for 5 minutes at 4 ' ~ . Pellets were re- suspended in 100 ul STET buffer per ml of culture ( Sambrooke et al., 1989), vortexed to fully re- suspend the pellet, and 10 ul of fresh lysozyme ( I 0 mglml) per 100ul STET buffer added and incubated at 95 OC for 70 seconds. Suspensions were centrifuged for 15 min at 12,000 X g at R. T. Cellular debris was removed using a sterile toothpick. DNA was precipitated with 110 ul of 100% isopropanol and incubated at - 20 OC. DNA was pelleted by centrifugation for 30 minutes at 12,000 X g, the aqueous phase aspirated, and the pellet air dried and re- suspended in 150- ul sterile water. All clone DNA preparations were quantified by spectrophotometry. Clone DNA amplification Insert DNA was amplified by PCR and visualized on ethidium bromide containing ( 2u1/ 100 ml ( 1 Omglml) 1 . I % agarose ( BRL) gels. PCR reactions were optimized using master mix solutions set for a reaction volume of 25ul and a DNA volume of 6 ul. Four master mix concentrations of MgC12 were used ( 1,2, 3, 4 mM MgCI2). Master mix solutions contained 10 X polymerase buffer ( Promega), 5 mM dNTP ( BRL), the appropriate amount of 25mM MgCh and water for 50 reactions. The appropriate volume of master mix solution ( 1 6.75 ul 1 25 ul reaction) was aliquoted into an iced sterile tube. Forward and reverse primers were added ( 1 ul20pM- primer solution 125 ul PCR reaction). TAQ polymerase ( Promega) ( 1- 1.25 units per reaction) were added to the master mix and aliquoted ( 19 ull reaction) on top of the previously added template DNA. A three- step PCR method was used: an initial 3 minute de- naturation at 94 OC for one cycle; and a three- step program of 45 sec de- naturation at 93 OC, 45 second annealing, and 60 second extension at 72 OC ( annealing temperatures varied with each clone and ranged between 45 and 58 OC). The PCR reaction was optimized for each clone by varying the MgCl2 concentration and annealing temperatures experimentally. Surveying copy number Amplified clones were sized on 1 .5% agarose gels using Hind Ill- restricted Lambda Phi X 174 size markers. Only clones in a size range of 300- 700 bp were used for further analysis. This size range corresponds with a single sequencing run on the ABI automated sequencer at Oregon State University. Based on insert size and measured concentration of the preparation, the volume that would contain 1 ug of insert DNA was calculated and this amount used to qualitatively examine copy number of each insert from the SNS genome ( Kafatos, et al., 1979). Using a vacuum slot blotting system, 1 ug of insert DNA was adjusted to 21 ul with water and the DNA denatured with 7 ul of 1 M NaOH ( final concentration of 0.2 M). The solution was incubated 5 min at 37 OC, placed on ice and 60 ul of 10 X SSC ( Sambrooke et al. 1989) added, resulting in a final volume of 90 ul. Using MSI nitropure nitrocellulose as the matrix, the DNA solution was applied to each well. All liquid was passed through the transfer membrane under vacuum. Each well was washed twice with 90 ul 1 OX SSC with the vacuum applied. Blots were removed and placed on wet 3mm Whatman filter paper. The DNA was linked to the membrane by an Ultra Lum ultraviolet crosslinker ( UVC 515) at 1200 X 100 microjoules. Blots were air dried and stored at - 2 0 ' ~. Each blot contained a positive control of total sucker DNA and a negative control of pUC 18 DNA. Probe preparation Probe preparation involved 2 ug of total Sau 3A1 restricted DNA ( Promega following the manufacturer's protocol). Digested DNA ( 31 5 ng) was labeled using alpha - 32 P - dCTP ( NEN) and the Multiprime system from Amersham. Unincorporated label and dNTP were eluted from the labeled probe DNA using Elutip- d ( Schleicher and Schuell) following the manufactures procedures. The resulting probe had a radiation level of 162,970 cpmlul and a specific activity of 92.7 uCi. Individual blots were layered between fine meshed sheets, placed into a hybridization bottle and pre- hybridized 1 hr at 65 OC in 200ml 5X SSC, 1 % sarcosyl in a Biometra hybridization oven. Probe DNA was denatured for 5 min at 9 5 ' ~ a nd placed on ice. Pre- hybridization solution was replaced with fresh 5X SSC and 1 % sarcoyl and contained 3 X 10 cpm labeled probe. Hybridization occurred overnight at 65 OC. In the morning, hybridization solution was removed and blots washed twice for 30 min each in 200 ml of 3 X SSC, 0.5% sarcosyl at 65 OC. The blots were further washed twice in 200 ml of 3 X SSC for 30 minutes. Blots were air dried for 60 minutes and placed on Kodak X- Omat Ar film at - 73'~ overnight. Films were developed using an automated X- Omat developer. Low copy number clones were identified by their weak signal on the film. Sequences with low copy number have less hybridization to the probe and have a weak photographic signal. Low copy number clones were 95% of all clones. Once low copy number clones were identified, some were randomly chosen for sequencing and primer selection. Clones were grown in 100ml cultures of ampicillin inoculated LB medium overnight at 3 7 ' ~ at 250 rpm. DNA was isolated using Fisher's Wizard Midiprep DNA isolation kit. DNA was quantified by spectrophotometry and diluted appropriately for the automated sequencer depending on insert size. Sequence primers used were standard forward and reverse primers for the pUC18 plasmid. Primer sites were approximately 50 bp from the start and end of the insert DNA. Raw sequence data was aligned by eye using the program SeqEd. Primer selection was performed by the program Oligo ( Version 4.0, National Biosciences Inc.) using the basic default parameters. Primers were synthesized at the Center for Gene Research ( Oregon State University) yielding 25- 40 nmoles of each primer. Primer stocks were prepared by diluting to 50 pM in water. PCR primer working stocks were prepared by diluting the stocks to 20pM. PCR optimization One individual from each of the four Klamath Basin suckers was used to find fixed differences between the species: D. luxatus AR- 002 ( 0s 01 5922) from Upper Klamath Lake, C. brevirostris AR- 041 ( 0s 01 596343) from the lower Williamson River, C. snyderi AR- 57 ( 0s 015900- F) from the upper Williamson River, and C. rimiculus AR- 105 ( 0s 01 5908- B) from Topsy Reservoir Each fish was amplified with a particular set of primers. Total PCR product was visualized on 2 % agarose gels containing ethidium bromide ( 2.5u11100ml gel 1 Omglml). Clean PCR products were cut from the gel and eluted using 0.45 om Ultrafree- MC filter units ( Millipore) following the manufacturer's protocol. Eluted DNA was precipitated with 111 oth of a volume of 3M sodium acetate and 2.2 volumes of 95% ethanol ( Sambrooke, et al., 1989) and re- suspended in 25 ul water. Re- suspended DNA ( 5 ul) was used on a mini- 2% agarose gel and quantified by comparison to a Hind Ill- restricted lambda PhiX 174 ladder. DNA was sequenced in both directions using the PCR primers and the sequences were aligned using SeqEd ( version 1.0.1. Applied Biosystems, Inc.). Once variation was detected either de- naturing polyacrylamide gel electrophoresis ( PAGE) or single stranded conformational polymorphism ( SSCP) analysis was used for population wide surveys ( Marklund, et al, 1995). PAGE was used for size variation detection. Gels were made of Long Ranger acrylamide ( FMC) following the manufactures' directions and a square tooth 55- sample comb. Gels were allowed to polymerize overnight. Gels were pre-warmed to 40- 50 OC. Individuals were amplified and 7 ul of amplified product were mixed with 5 ul of 100% formamide. Samples were denatured at 8 3 ' ~ fo r 3 minutes and placed on ice. Five ul was loaded into each well and the gel was run for 2- 3 hours at constant power of 50 watts at R. T. Gels were disassembled, overlaid with a gel staining gasket ( Wagman, in preparation) with the gasket secured by binder clamps. The gel was placed in the dark and stained with Sybr Gold ( Molecular probes) ( 50ulI 500ml of 0.6~ TB E pH 8.0) for 30 minutes. Gels were inverted and illuminated on an UV light source and photographed with a Kodak MP- 3 system using Polaroid 667 film. SSCP gels were made from MDE acrylamide ( FMC) following the manufactures' protocol. Gels polymerized overnight with a square tooth 55- sample comb. Gels were set up on the bench at room temperature. Samples were prepared as for PAGE, 5ul were loaded into each lane and the gel was run for 5 minutes at 50 watts to allow the samples to fully penetrate the gel matrix. The gel was disconnected from its power source and moved into a 4 OC cabinet. Gels ran for 20- 24 hours at 4 watts per gel. Gels were stained and photographed in a similar manner as PAGE. Basic population statistics were generated using web based Genepop program ( Raymond and Rousset, 1995). Statgraphics plus ( version 3.0, 1997) was also used for statistical comparisons. RESULTS Forty- four clones had their DNA inserts sequenced for primer selection ( Appendix 2). Twenty- eight DNA inserts were successfully amplified and sequenced in each of the four species ( Table 1). The remaining 16 inserts were either difficult to optimize in all species, were duplicates of another insert, or were not used for primer selection. Appendix 2 contains the sequence, PCR primers, PCR conditions, and the protein and nucleic acid sequence homologies for each insert as determined in Genbank. In the following, we refer to each of these inserts as a genetic locus, identified by an arbitrary numbering system or by the name of the coded protein. Each locus successfully amplified different numbers of individuals. For the 28 randomly chosen loci, we sequenced and aligned 10,421 base pairs. Twenty- one of 28 loci had open reading frames and were homologous to proteins found in Genbank ( overall 70.5% ( 31144) of the loci in this study contained open reading frames ( ORF)). We found no fixed sequence differences between Klamath Basin sucker species, but suckers outside Klamath Basin ( outgroups) exhibited unique sequence variation for at least two loci ( 4 and 184). Eight loci were polymorphic with two or more alleles, four had rare variants and four had common variants. Rare variants The rare variant group contained loci 1 17, 1 19, I26 and 146. Locus 1 17 had no open reading frame ( ORF) and weak homology ( 21 nucleotides ( nt)) to a human sequence on chromosome 22q12. The two alleles were the result of a position 123 transition ( C+ T) but the rare allele was only found in two of 150 individuals ( both KSS). Locus 11 9 also had no ORF and weak homology ( 1 9nt) to a human sequence on chromosome 12~ 13. T he two alleles were the result of a position 361 transversion ( G+ T) but the rare allele was again only found in two of 150 individuals ( both KSS). Locus I26 contained an ORF that had 61 % identity and 72% overall homology ( 1 9126 amino acids ( aa)) to a highly specific repeat in ORFI found in Baffrachocoffus baikalensis ( Kholodilov, N. G., unpublished). The two alleles were the result of a position 143 transition ( G+ A) but the rare allele was only found in 2 of 48 individuals ( SNS and LRS). Locus 146 had an ORF and was moderately homologous to a protein in the nematode Caenorhabditis elegans ( 23133 aa) and had strong homology to a 26 nt long Danio rerio mRNA sequence. Locus 146 had 2 alleles caused by a position 249 transversion ( G+ A) but the rare allele was only found in 2 of 48 individuals ( both KSS). Common variants The common variant group contained loci 4 and 120 ( size deletion alleles) and 142 and I84 ( sequence variant alleles). Locus 4, Collagen I Locus 4 had 59% identity ( 73% overall homology, 20127 aa) to Collagen 1 gene from Ephydatia muelleri. Locus 4 had two alleles caused by a 10- bp deletion between positions 260- 270. ( Appendix 2) and exhibited allelic frequency differences between the four Klamath Basin species ( Table 2). LRS and SNS had very high frequencies of allele A ( 95 and 99% respectively), KLS intermediate ( 81 %), and KSS low frequency ( 1 8%). The frequencies were significantly different ( ANOVA, p= 0.00001). A Fisher's multiple range test identified three groups, SNS plus LRS, SNS plus KLS, and KLS plus KSS. In the Rogue River, all KSS were fixed homozygotes, BB, and in Upper Klamath Lake all species were fixed homozygotes, AA ( Figure 1). If Collagen 1 is a species maker, all KSS are BB, and all SNS, KLS, and LRS are AA. All heterozygotes ( AB) would be F1 hybrids or F2+ backcrosses and some F2+ backcrosses could show a parent genotype. However, the B allele is widespread in the Lost River and Williamson River subbasins of the Upper Klamath Basin and only one KSS has ever been documented in the upper basin ( Figure 1). Therefore, if Collagen 1 is a species marker, hybrids must be viable to account for the frequencies in the upper basin and hybridization is either on- going or ancient with the B allele maintained by random mating. Collagen 1 also showed interesting differences between outgroup and Klamath Basin species ( data not shown). A coastal C. macrocheilus had a single base pair insert. A nominal C. macrocheilus from Hood River had a large ( ca. 20 bp) deletion. C. occidentalis had an I I or 12- bp deletion. Other C. macrochielus, C. sp. ( Wall Canyon), and X. texanus were similar in PAGE profile to Klamath Basin suckers. Locus 120, Aldehyde dehydrogenase Locus 120 had 45% identity ( 69% overall homology, 26/ 37 aa) to a tumor associated aldehyde dehydrogenase from Ratus norvegicus ( Appendix 2). The aldehyde dehydrogenase locus exhibited allelic frequency differences between the four Klamath Basin species ( Table 3) based on a four bp deletion. SNS and KLS had high frequencies of allele A ( 86- 87%), LRS was intermediate ( 76%) and KSS had the lowest frequency ( 26%). The frequencies were significantly different ( ANOVA, p= 0.00001). Fisher's multiple range test identified three groups, SNS plus KLS, LRS, and KSS. In the Rogue River, 72% of KSS were fixed homozygotes, BB, and in Upper Klamath Basin 71 % of all species were fixed homozygotes, AA ( Figure 2). No case can be made that any of the four species is fixed for either allele. Both alleles must pre- date differentiation of the species or indicate ancient hybridization prior to Klamath KSS dispersal into the Rogue River, or separation from the Klamath Basin. Locus 142 Locus 142 did not have an ORF and had weak sequence homology ( 21 nt.) to a human chromosome 5 sequence. Locus 142 has at least 12 alleles in 7 genotypes based on SSCP analysis. The locus has not been fully investigated at this time. Locus 142 was polyploid because individuals had up to three different alleles. Because catostomids are allotetraploids ( Ferris and Whitt 1978, Buth 1979) we assume this is a tetraploid locus. Twelve alleles have been found, but only eight have been sequenced. Alleles B, C, D, E, migrate very closely to the A allele and therefore isolation has been difficult. The A allele is identical to the clone sequence. Locus 142 showed allelic segregation because all alleles were not equally available to all genotypes ( Figure 3). Assuming that B, C, D, and E alleles have similar sequences to A, genotype groups appear to have closely related alleles ( Figure 3A). Genotypes 1- 4 only have A- E alleles, genotype 6 only has F- H alleles, genotype 7 only has 1 and J alleles and genotype 8 only has K and L alleles ( Figure 3B). The F, G, and H alleles share unique changes at positions 40 and 350 and the 1 and J alleles share a unique change at position 59 ( Figure 3). Only genotype 8 alleles appear to deviate from this pattern. Alleles G and H had the greatest amount of changes from A, with 2 base pair plus an 80 bp repeat ( G) and a 70 bp deletion ( H). The most common genotype group contains the A allele and was found in all four Klamath Basin suckers, but with different frequencies ( Table 4). Genotype 1 occurred in 50% of SNS, 46% of LRS, 34% of the KLS and 4% of KSS. Genotype 3 was the dominant genotype in KSS ( 70%). Genotype 6 occurred in 21 specimens of SNS from Upper Klamath Lake, Sprague River and Clear Lake. Genotype 7 was found in all species and accounted for 9% of SNS, 15% of KLS, 20% of KSS and 37% of LRS. Major genotypes per species were: SNS, genotypes 1,2 and 6 ( 81 % of specimens); KLS, genotypes 1,2,3, and 7 ( 93%); KSS, genotypes 3 and 7 ( 90%); and LRS, genotypes 1 and 7 ( 83%). Locus 184, AnkyrinG Locus 184 had 88% identity ( 99% overall homology, 1811 8 aa) to human AnkyrinG ( Kordeli, et al 1995). Locus 184 had two alleles caused by a position 353 transversion ( C3A) and exhibited allelic frequency differences between the four Klamath Basin species ( Table 5). Frequencies of allele A were significantly different between the four species ( ANOVA, p= 0.01 33). Fisher's multiple range test identified three groups, SNS plus LRS, SNS plus KLS, and KSS plus KLS. Throughout the basin, Ankyrir~ g; enotype frequencies were similar and most fish ( 89%) were heterozygous. No fish were homozygous BB. Ankyrin~ S SCP variation in outgroups ( Figure 4) was considerable and showed all species possessed the common A allele plus a unique secondary allele. All outgroups were heterozygous. The first 100 bp of sequence data were unclear for Ca. occidentalis and one Ca. macrocheilus from Hood River ( Table 6). Excluding these bases, the KlamathIRogue allele B was most like the A allele, differing only at the position 353 transversion. All outgroup secondary AnkyrinG alleles shared a substitution at position 140. Among outgroups, the secondary allele in Ca. occidentalis was the most similar to allele B, differing only at positions 140 and 209. Considering the lack of variation in the secondary allele in the four Klamath Basin species, the variation in five specimens of the nominal Ca. macrocheilus was huge. The secondary alleles in two specimens collected about a month apart in Hood River ( 0s 15885 and OS 15886) differed at 19 positions. One of these ( Hood A) was more like coastal Ca. macrocheilus from Woahink Lake ( Siuslaw drainage) than the other Hood River fish, yet also differed from coastal Ca. macrocheilus at 15 positions. DISCUSSION Our selection of low copy number anonymous nuclear loci resulted in a large number of structural genes ( 70.5% ORF). Surprisingly, among the four species and three genera of Klamath Basin suckers, there were no fixed differences in 10,421 bp from 28 randomly selected loci. Only eight loci were polymorphic and only four of these had common variants. Among the common variant loci, we found three types of species markers: strictly diagnostic, operationally diagnostic and frequency dependent. We define a strictly diagnostic species marker as an allele or genotype that is only found in one species and indicates than an individual can be identified to species. An operationally diagnostic species marker is an allele or genotype fixed for one population ( drainage or sub basin) of a species and may, with corroborative information, indicate that an individual can be identified to species. A frequency dependent species marker is an allele or genotype showing a statistically significant difference in frequency between species and may, with corroborative information, indicate that a population can be identified to species. In the Klamath/ Rogue basins among the common variant loci, genotype 6 of locus 142 was strictly diagnostic. Genotype 6 was only found in SNS, but not in all SNS ( Table 4). The genotype was not geographically restricted and appears to be a good, but limited, species marker for SNS. The homozygous BB genotype of Collagen 1 was operationally diagnostic for KSS in the Rogue River ( Figure 1). The Rogue River sample was limited to one site on a single day and may represent a single spawning group or sampling artifact. The B allele of Aldehyde dehydrogenase was a frequency- dependent marker for KSS ( Figure 2). Again, 72% of the Rogue River fish were homozygous, BB, for this locus and sampling artifact can not be dismissed. The analysis indicated that the catostomid genomes of KlamathIRogue basins were conserved and highly related. The sequence similarity of random loci and low levels of polymorphism of those loci across the four species does not support their current classification in three genera. Further, most differences followed geographic, rather than taxonomic, patterns with KSS from the lower Klamath Basin and Rogue River more often the " distinct" entity while species from three genera in Upper Klamath Basin ( SNS, LRS, and KLS) were more similar ( Figures 1 and 2). The alleles for locus 142 did not exhibit random assortment. If they did, alleles of all types should be found together, such as A with F, G, H, I, J, K, or L. This has not been found ( Table 4) and suggests either assortative mating through mate recognition or selection against particular allele combinations. AnkyrinG illustrated that low copy number anonymous nuclear loci can provide strictly diagnostic species markers in other catostomids. The Ca. macrocheilus group was especially variable. One form differed by 19 and 15 positions from two other forms of nominal Ca. macrocheilus. In the four Klamathl Rogue species there were no differences, again suggesting genetic relatedness of suckers within the basin. These preliminary data need to be integrated with other molecular and morphological data to better understand their meaning. We believe there are at least four biological species of suckers in the KlamathIRogue basins. Our data indicate they may be hybridizing, but that they also may show assortative mating ( locus 142, especially genotype 6). At this point, it is not clear if hybridization is a natural and necessary source of genetic variation, as would be expected from a syngameon, or a waste of each species' reproductive potential. Consequently, it is not currently advisable to make management decisions detrimental to hybrids. Literature Cited Buth, D. G. 1979. Duplicate gene expression in tetraploid fishes of the tribe Moxostomatini ( Cypriniformes, Catostomidae). Comp. Biochem. Physiol., 63b, 7- 12. Buth, D. G., Murphy, R. W., Ulmer, L. 1987. Population differentiation and introgressive hybridization of the Flannelmouth sucker and of hatchery and native stocks of the razorback sucker. Transactions of the American fisheries Society. 11 6110 3- 1 10. Crabtree, C. B., Buth, D. G. 1987. Biochemical systematics of the catostomid genus Catostomus: assessment of C. clarki, C. plebeius, and C. discobolus including the Zuni sucker, C. D. yarrowi. Copeia. 4: 843- 854. Ferris, S. D., Whitt, G. S. 1978. Phylogeny of tetraploid catostomid fishes based on the loss of duplicate gene expression. Systematic Zoology. 27( 2) 189- 206. Kafatos, F. C., C. W. Jones, A. Efstratiadis. 1979. Determination of nucleic acid sequence homologies and relative concentrations by a dot hybridization procedure. Nucleic acid research. 7: 6; 1541 - 1 552 Karl, S. A., Bowen, B. W., Avise, J. C. 1992. Global population genetic structure and male- mediated gene flow in the green turtle ( Chelonia mydas): RFLP analysis of anonymous nuclear loci. Genetics. 131 : 163- 1 73. Kocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V., Paabo, S., Villablanca, F. X., Wilson, A. C. 1989. Dynamics of mitochondria1 DNA evolution in animals: amplification and sequencing with conserved primers. Proceedings of the National Academy of Science USA. 86: 61 96- 6200. Marklund, S., Chaudhary, R., Marklund L., Sandberg, K., Andersson, L. 1995. Extensive mtDNA diversity in horses revealed by PCR- SSCP analysis. Animal Genetics. 26, 193- 1 96. Miller, R. R., Smith, G. R. 1981. Distribution and evolution of Chasmistes ( Pisces: Catostomidae) in North America. Occasional papers of the Museum of Zooloqv, University of Michigan. 696: 1- 46. Sambrook, J., Fritsch, E. F., Maniatis, T. ( eds.). 1989. Molecular cloning: a Laboratory Manual, 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, . - New York. Raymond M., Rousset, F. 1995. Genepop: population genetics software for exact tests and ecumenicism. J. Heredity, 86: 248- 249 ( web based version at http:// wbiomed. curtin. edu. au/ qenepop/ index. html) Taggard, J. B., Hynes, R. A., Prodohl, P. A., Ferguson, A. 1992. A simplified protocol for routine total DNA isolation from salmonid fishes. Wagman, D. W., in preparation. Perfect Gels and Staining. Table 1. List of 28 anonymous nuclear loci used in this study. Search type refers to either a protein ( aa) search using the blastn program or a nucleic acid search using the blastx program. Locus # PCR size 50 1 454 543 348 320 42 1 338 286 21 5 278 305 190 249 261 262 482 372 543 498 search type protein protein protein protein nucleic acid protein protein nucleic acid protein protein nucleic acid nucleic acid protein protein protein nucleic acid nucleic acid nucleic acid protein protein nucleic acid protein nucleic acid residues 20122 aa 16/ 27 aa 14/ 36 aa 22/ 74 aa 39/ 41 nt 17/ 32 aa 4011 25 aa 32/ 36 nt 13/ 39 aa 28/ 30 aa 75/ 88 nt 23/ 24 nt 17/ 49 aa 21/ 34 aa 16/ 40 aa 20120 nt 20120 nt 34/ 34 nt 19/ 28 aa 23/ 64 aa 14711 56nt 23/ 85 aa 21/ 21 nt 18 Homology unknown protein [ Mycoplasma genitalium] collagen COLFI - freshwater sponge [ Ephydatia muelleri] NADH dehydrogenaes subunit 8 [ Crithidia oncopelti] 13KD protein [ Saccharomyces cerevisiae] diphtheria toxin repressor ( dtxR) gene [ Coryne bacterium diphtheriae] probable membrane protein [ Saccharomyces cerevisiae] serinetthreonine kinase, [ Homo sapiens] ependymin ( sh) precursor gene [ Notropis chrysoleucas] hypothetical protein HI1 195 [ Haemophilus influenzae] myelin basic protein kinase- like protein [ Xenopus lae vis] ERK2, exon 1 [ Mus musculus] cosmid TI 0B9, [ Caenorhabditis elegans] potassium channel [ Rattus norvegicus] KIAA0335, [ Homo sapiens] pyruvate, orthophosphate dikinase [ Thermotoga maritima] cadherin- 7 ( CDH7) mRNA [ Homo sapiens] mRNA for guanylyl cyclase C [ Xenopus laevis] Rat transferrin receptor mRNA, 3' end. Hypothetical protein Rv2035 [ Mycobacterium tuberculosis] AbcA [ Dictyostelium discoideum] transposon Tsnl - 3 transposase pseudogene [ Salvelinus namaycush] Hypothetical protein, len: 1676 aa [ Plasmodium falciparum] Human DNA sequence from PAC 272Jl2 on chromosome 22q12- qter nucleic acid protein protein nucleic acid protein nucleic acid protein protein protein protein 12p13 BAC RPCII 1- 43619 [ Homo sapiens] tumor- associated aldehyde dehydrogenase [ Rattus norvegicus] orf2 [ Battrachocottus baikalensis] chromosome 5, Pac clone 16201 7 ( LBN L H l4i'[ Homo sapiens] No definition line found [ Caenorhabditis elegans] no arches ( nar) mRNA [ Danio rerio] hypothetical protein HI1 41 8 [ Haemophilus influenzae Rd] brain- specific angiogenesis in hi bitor 1 precursor [ Homo sapiens] ankyrin G [ Homo sapiens] envelope glycoprotein [ Human immunodeficiency virus type I ] Total: Table 2: Genotypic and allelic frequencies ( Freq) for Collagen 1 for all species and sites. n = sample size. Species Site n AA AB BB Freq A Freq B KLS KSS LRS SNS KLS LRS KLS KLS SNS KLS LRS SNS KSS LRS SNS KLS SNS LRS SNS LRS SNS KLS KSS SNS KSS SNS SNS ALL Sprague Sycan Rocky Ford Lower Williamson UKL Gerber Lost River Clear Lake T ~ P ~ Y Copco Rogue River Hatchery TOTAL 289 20 Table 3: Genotypic and allelic frequencies ( Freq) for aldehyde dehydrogenase for all species and sites. n = sample size. Species Site n AA AB BB Freq A Freq B SNS KLS KSS LRS SNS KLS LRS KLS KLS SNS KLS LRS SNS KSS LRS SNS KLS SNS LRS SNS LRS SNS KLS KSS SNS KSS SNS ALL Sprague Sycan Rocky Ford Lower Williamson UKL Gerber Lost River Clear Lake T ~ P ~ Y Copco Rogue River Hatchery TOTAL 270 21 Table 4: Genotypic ( GT) frequencies for Locus 142 for all species and sites. n = sample size. Species Site GTI GT2 GT3 GT4 GT6 GT7 GT8 SNS KLS KSS LRS SNS KLS LRS KLS KLS SNS KLS LRS SNS KSS LRS SNS KLS SNS LRS SNS LRS SNS KLS KSS SNS KSS SNS ALL ALL ALL ALL Sprague Sycan Rocky Ford Lower Williamson UKL Gerber Lost River Clear Lake T ~ P ~ Y Copco Rogue River Hatchery failed Table 5: A n k y r ig~ e notypic and allelic frequencies by species and site. Species SNS KLS KSS LRS SNS KLS LRS KLS KLS SNS KLS LRS SNS KSS LRS SNS KLS SNS LRS SNS LRS SNS KLS KSS SNS KSS SNS Total site All Sprague Sycan Rocky Ford Lower Williamson UKL Gerber Lost River Clear Lake T ~ P ~ Y Copco Rogue River Hatchery Freq A 0.56 0.52 0.51 0.61 0.6 0.5 0.6 0.57 0.52 0.54 0.5 0.5 0.5 0.5 0.63 0.57 0.5 0.5 0.5 0.59 0.63 0.5 0.5 0.53 0.5 0.5 0.5 Freq B 0.44 0.48 0.49 0.39 0.4 0.5 0.4 0.43 0.48 0.46 0.5 0.5 0.5 0.5 0.37 0.43 0.5 0.5 0.5 0.41 0.37 0.5 0.5 0.47 0.5 0.5 0.5 Table 6 : An kyrinG sequences for alleles A and B, Catostomus occidentalis, Catostomus wallcanyon, Xyraunchan texanus, Catostomus marcocheilus A and B from Hood River and Catostomus marcocheilus from the coast. Sequence Allele A: Allele B: Ca. occidentalis Ca. wallcanyon X. texanus Ca. macrocheilus Hood A Ca. macrocheilus Hood B Ca. macrocheilus Coastal Allele A: Allele B: Ca. occidentalis Ca. wallcanyon X. texanus Ca. macrocheilus Hood A Ca. macrocheilus Hood B Ca. macrocheilus Coastal Allele A: Allele B: Ca. occidentalis Ca. wallcanyon X. texanus Ca. macrocheilus Hood A Ca. macrocheilus Hood B Ca. macrocheilus Coastal AGGGCCTGAG AGGGCCTGAG AGGGCCTGAG AGGGCCTGAG AGGGCCTGAG AGGGCCTGAG AGGGCCTGAG AGGGCCTGAG AGCATAAGAT AGCATAAGAT AGCATAAGAT AGCATAAGAT AGCATAAGAT AGCATAAGAT AGCATAAGAT AGCATAAGAT GAAAAACTAT GATG- AATAT TTTAGTACAT ATTTTTT CAG GAAAAACTAT GATG- AATAT TTTAGTACAT ATTTTTT CAG AA GTG GAAAA- CTAT GA- G- AATAT TTTAGTACAT ATTTTTT CAG GAAAACCTAT GA- G - AATAT TTTAGTACAT ATTTTT-- CAG GGATA-- CTAT GA- GAAATAT TGTAGTACAT ATTTTT--- CAG GATA- G TGTGATGATG GGAAA- CTAT GA- GCAATAT TGTAGTACAT ATTTTT-- CAG 70 80 90 100 110 120 AGAAGTTAGA A AACTAATGC AGC- AGATTG -- CCCTTT TCTGGTCAAG CAAAGATAAT AGAAGTTAGA A AACTAATGC AGC- AGATTG ---- CCCTTT TCTGGTCAAG CAAAGATAAT TATAGAGAAC TAAGTGCTGC AGGATCTGCG ----- CCTTT TCTGGTCAAG CAAAGATAAT AGAAGTTAGA AAACTAATGC AGC- AGATTG ---- CCCTTT TCTGGTCAAG CAAAGATAAT AGAAGTTAGA AAACTAATGC AGC- AGATTG ---- CCCTTT TCTGGTCAAG CAAAGATAAT AGAAGTTAGA AAACTAATGC AGC- AGATTG -- CCCTTT TCTGGTCAAG CAAAGATAAT GATCTCCATG - GCACGTCG AG- AG---- TG TCGCTCCTTT TCTGGTCAAG CAAAGATAAT AGAAGTTAGA AAACTAATGC ACGCAGATTG --- CCCTTT TCTGGTCAAG CAAAGATAAT 130 140 TAAGGTTTCA GAGAGATTTG TAAGGTTTCA GAGAGATTTG TAAGGTTTCA GAGAGATTTT TAAGGTTTCA GAGAGATTTT TAAGGTTTCA GAGAGATTTT TAAGGTTTCA GAGAGATTTT TAAGGTTTCA GAGAGATTTT TAAGGTTTCA GAGAGATTTT 150 160 170 180 TGCATTGAAC TGTGCAAACG TTTTCGGCAC AATAAATGTG TGCATTGAAC TGTGCAAACG TTTTCGGCAC AATAAATGTG TGCATTGAAC TGTGCAAACG TTTTCGGCAC AATAAATGTG TGCATTGAAC TGTGCAAACG TTTTCGGCAC AATAAATGTG TGCATTGAAC TGTGCAAACG TTTTCGGCCC AATAAATGTG TGCATTGAAC TGTGCAAACG TTTTCGGCCC AATAAATGTG TGCATTGAAC TGTGCAAACG TTTTCGGCCC AATAAATGTG TGCATTGAAC TGTGCAAACG TTTTCGGCCC AATAAATGTG Allele A: Allele B: Ca. occidentalis Ca. wallcanyon X. texanus Ca. macrocheilus Hood A Ca. macrocheilus Hood B Ca. macrocheilus Coastal Allele A: Allele B: Ca. occidentalis Ca. wallcanyon X. texanus Ca. macrocheilus Hood A Ca. macrocheilus Hood B Ca. macrocheilus Coastal Allele A: Allele B: Ca. occidentalis Ca. wallcanyon X. texanus Ca. macrocheilus Hood A Ca. macrocheilus Hood B Ca. macrocheilus Coastal 190 200 21 0 220 230 240 TCAATG TTTC ACATTTCTCT TAAACTGGTT ATTTTATATC TTCATCTTAA GTGTGTCAGT TCAATG TTTC ACATTTCTCT TAAACTGGTT ATTTTATATC TTCATCTTAA GTGTGTCAGT TCAATGTTTC ACATTTCTCT TAAACTGGCT ATTTTATATC TTCATCTTAA GTGTGTCAGT TCAATGTTTC ACATTTCTCT TAAACTGGTT ATTTTATATC TTCATCTTAA GTGTGTCAGT TCAATGTTTC ACATTTCTCT TAAATTGGTT ATTTTATATC TTCATCTTAA GTGTGTCAGT TCAATGTTTC ATATTTCTCT TAAACTGGTT ATTTTATATC TTCAGCTTAA GTGTGTCAGA TCAATGTTTC ATATTTCTAT TAAACTGGTT ATTTTATATC TTCAGCTTAA GTGTGTCAGA TCAATGTTTC ATATTTCTCT TAAACTGGTT ATTTTATATC TTCAGCTTAA GTGTGTCAGA 250 260 270 280 290 GGGAAGTATC GATTTTAGAT TTCCCCTGTC ACAAAAATCT AATGAAAAAA GGGAAGTATC GATTTTAGAT TTCCCCTGTC ACAAAAATCT AATGAAAAAA GGGAAGTATC GATTTTAGAT TTCCCCTGTC ACAAAAATCT AATGAAAAAA GGGAAGTATC GATTTTAGAT TTCCCCTGTC ACAAAAATCA AATGAAAAAA GGGAAGTATC GATTTTAGAT TTCCCCTGTC ACAAAAATCT AATGAAAAAA GGGAAGTATC GA---- TAGAT TTCCCCTGTC ACGAAAATCA AATGAAAAAA GGGAAGTATC GA---- TAGAT TTCCCCTGTC ACGAAAATCA AATGAAAAAA GGGAAGTATC GA------ TAGAT TTCCCCTGTC ACGAAAATCA AATGAAAAAA 31 0 320 TGGATAAAAG GAGTGAGGAA TGGATAAAAG GAGTGAGGAA TGGATAAAAG GAGTGAGGAA TGGATAAAAG GAATGAGGAA TGGATAAAAG GAGTGAGGAA TGGATAAAAG GGGGGGGGAA TGGGTAAAAG GGGGGGGGGA TGGATAAAAG GGGGGGGGAA 330 340 350 TATTTTTTCT TTTGTAATTG ATAAAGACTC TATTTTTTCT TTTGTAATTG ATAAAGACTC TATTTTTTCT TTTGTAATTG ATAAAGACTC TATTTTTTCT TTTGTAATTG ATAAAGACTC TATTTTTTCT TTTGTAATTG ATAAAGACTC ATTTTTTTTT TTTGGAATTG GAAAAACCCC AATTTTTTTT TTT TTAATTG AGAAAAACTC ATTTTTTTTT TTT TGAAATT GAAAAAGCCC 300 AAAGAAAGT AAAAGAAAGT AAAAGAAAGT AAAAGAAAGT AAAAGAAAGT AAAAGAAAGT AAAAGAAAGT AAAAGAAAGT 360 ATGGATTATT ATTGATTATT ATGGATTATT ATGGATTATT ATGGATTATT AAGGGTTTTT AGGGGTTTTT CA- GGGATTT Allele A: Allele B: Ca. occidentalis Ca. wallcanyon X. texanus Ca. macrocheilus Hood A Ca. macrocheilus Hood B Ca. macrocheilus Coastal Allele A: Allele B: Ca. occidentalis Ca. wallcanyon X. texanus Ca. macrocheilus Hood A Ca. macrocheilus Hood B Ca. macrocheilus Coastal TATTTTTCAT CCAAACATTC CTTGTGCAAA TAGAATAGAA TAGAAGAAGT CCTGCAACAT TATTTTTCAT CCAAACATTC CTTGTGCAAA TAGAATAGAA TAGAAGAAGT CCTGCAACAT TATTTTTCAT CCAAACATTC CTTGGGCAAA TAGAATAGAA TAGAAGAAGT CCTG CAACAT TATTTTTCAT CCAAACATTC CTTGTGCCAA TAGAATAGAA GCTA- G------ T CC- GGAACAT TATTTTTCAT CCAAACATTC CTTGAGGAAA TAGAGTAGAA TAGAAG---- T CCTGCAACAT TTTTTTTTAA GCCA- ACCTT TC- TTTGGCA AAAAAAAAAA AAAAAAAGCC CCCCCCCAAT TTTTTTTTTT GCACACATTT TTTTTGCAAA AAAAAAAAAA AAAAAAAAGC CCTCCACCAT TTTTTTTTTC ATCCAAACAT TTCC- TTGGC AAAAAAAAAA AAAAAAAAGC CCCCCCGCAT 430 439 ATGGTATGGT CCCAGGACT ATGGTATGGT CCCAGGACT ATGGTATGGT CCCAGGACT ATGGTATGGT CCCAGGACT ATGGTATGGT CCCAGGACT ATGGTATGGT CCCAGGACT ATGGTATGGT CCCAGGACT ATGGTATGGT CCCAGGACT 1 - - - -- -. t - - - - - . -- -- species GT KSS AA SNS AA -- - 1- 1- - - ~ Phcenrx I_ ) Williamson - t~ gure1 : D~ strlbut~ oann d number ( n) tor Gollagen I genotypes tor all 1 species in each sub- basin n= 292. I Rogue River rspecies r - Upper Klamath Lakt species I KSS SNS LRS 2 Klamath River 4species SNS I Lost River drainage 1 species - Spraguel Sycan Rivers species SNS I t ~ gure2 : ulsrrltxmons ana numDers ( n) or Hlaenyae aenydrogenase genotypes for all species in each subbasin n= 270. B- Locus 142 GENOTYPE # 1 2 3 4 6 7 8 ALLELES A4 A262 A2C2 A2Di EI F2 GI HI ) 2 J2 K2 L2 Figure 3: A- Line diagrams representing 8 of the 12 alleles for Locus 142. " A" allele is identical to the clone sequence. Sequence that deviates from the A allele is represented by a vertical bar with the corresponding base under it. B-Genotype number and alleles found in that genotype. AR AR HiLo HiLo I S LS KIS S Figure 4: SSCP genotypes of Klamath basin and outgroup catostomids. Allele A is found in all suckers; Allele B is found in Klamath Basin suckers; Allele C is found in C. occidentalis; Allele D is found in C. macrocheilus ( Columbia); Allele E is found in X. texanus; Allele F ( not shown) is found in C. sp. ( wall canyon); Allele G is found in C. macrocheilus/ tslitcoosa ( Coastal) Appendix 1 : Klamath basin adults collected by BOR by location. Fish are listed by OS catalogue number, alpha, sample number, tag number, Genus, species, and sample status. Sample status lists the Loci number( s) each fish was used for. " Complete" means a fish was amplified in loci 4, 120, 142, 184. " No" means a sample was not available. Catalog, Alpha, Number, Tag number, Genus species, Sample status Sprague River: OS 01 5895, A, 200, BR00962, Catostomus snyderi," 4,184,142" OS 01 5895, B, 201 , BR00966, Catostomus snyderi, complete OS 015 895, CY202, BR00968, Catostomuss nyderi," 4, 120, 142" OS 015 895, D, 203, BR00965, Catostomus snyderiYw41,4 2" OS 01 5895, E, 204, BR00963, Catostomus ~ nyderi~ complete OS 01 5895, F ,205, BR00964, Catostomus snyderi, complete OS 015 895, G, 206, BR00967, Catostomuss nyderiYw41,2 0, 142" OS 01 5893, A, 308, BR00413, Catostomus snyderi, complete OS 01 5893, BY309, BR00414, Catostomus snyderi, complete OS 015 893, CY3Ol , BROO4l~, Catostomuss nyderi," 4,142" OS 01 5893, D ,3l I, B ROO4l6, Catostomus snyderi, complete OS 01 5893, E, 31 2, BR00418, Catostomus ~ nyderi~ complete OS 01 5893, F, 31 3, BR00419, Catostomus snyderi, no OS 01 5893, G, 314, BR00420, Catostomus snyderi, complete OS 01 5893, J, 31 5, BR00421 , Catostomus snyderi," 4,120, 184" OS 01 5893, H, 31 6, BROO422, Catostomus snyderi, no OS 01 5893,1,317, BROO423, Catostomus snyderi, 4 OS 01 5894, A, 318, BROO424, Catostomus ~ nyderi~ complete OS 01 5894, B, 3l9, BROO425, Catostomus snyderi," 4,120, 142" OS 01 5894, C, 320, BR00576, Catostomus snyderi, complete OS 01 5894, D, 321 , BR00577, Catostomus snyderi, no OS 01 5894, E, 322, BR00579, Catostomus ~ nyderi~ complete OS 01 5894, F ,323, BR00580, Catostomus snyderi, no OS 01 5894, G, 324, BROO58l , Catostomus snyderi, complete OS 01 5894, HY325, BR00582, Catostomuss nyderi, complete OS 01 5894,1,326, BR00583, Catostomus snyderi, no OS 01 5894, J, 327, BR00584, Catostomus snyderi, complete OS 01 5894, K, 328, BR00585, Catostomus snyderi, no OS 01 5894, L, 329, BR00586, Catostomus snyderi, no OS 015894, M, 330, BR00587, Catostomus ~ nyderi~ complete OS 01 5894, N, 33 1, BR00588, Catostomus snyderi, no OS 01 5894,0,332, BR00589, Catostomus snyderi, complete OS 015894, PY333, BR00590, Catostomus snyderi, no OS 01 5956, A, 01 6, G01549, Chasmistes brevir~ stris~ complete OS 01 5956, B, 018, G01601 , Chasmistes brevirostris, complete OS 01 5956, C, 01 9, G01602, Chasmistes brevir~ stris~ complete OS 01 5924, C, 023, G01606, Chasmistes brevirostris, no OS 01 5957, A, 027, BR00244, Chasmistes brevirostris, complete OS 01 5957, B ,030, BR00242, Chasmistes brevirostris, complete OS 01 5923, B, Ol7, GOl6OO, Deltistes luxatus," 4, 120, 184" OS 01 5923, A, 020, G01 603, Deltistes luxatus, complete OS 01 5924, A, 021 , GO1 604, Deltistes luxatus, complete OS 01 5924, BY022, GO16 05, Deltistes luxatus, complete OS 01 5924, D, 024, G01 607, Deltistes luxatus, no OS 01 5925, B ,028, BR00240, Deltistes luxatus, no OS 015 925, A9029, BR00241, D eltistes luxatus, complete Sycan River: OS 01 5897, AI077, GF01 630, Catostomus snyderi, complete OS 01 5897, B ,078, G F01629, Catostomus snyderi, complete nonlethal,, 083, NA, Catostomus snyderi, no nonlethalY, 084, NA, Catostomus snyderi, no OS 01 5898, A, 120, G01792, Catostomus snyderi, complete OS 01 5898, B, 1 21 , GO1 790, Catostomus snyderi, complete OS 01 5898, C, 122, G01789, Catostomus snyderi, complete OS 01 5898, D, 123, GOI 788, Catostomus snyderi, complete OS 01 5968,, 124, G01787, Catostomus snyderi, complete Upper Williamson River: Rocky Ford OS 01 5903, A, 025, GF01608, Catosfomus snyderi, complete OS 01 5903, B, 026, BR00243, Catostomus snyderi, complete OS 01 5903, C, 033, BR00245, Catostomus snyderi, complete OS 01 5903, D ,034, BR00246, Catostomus snyderi, complete OS 01 5904, A, 049, G01616, Catostomus snyderi, complete OS 01 5904, B ,050, NA, Catostomus snyderi, no OS 015 900, AY051, G O1 617 , Catostomus snyderi," l20,184" OS 01 5900, B, 052, G01 61 8, Catostomus snyderi, complete OS 01 5900, C, 053, G01619, Catostomus snyderi," 4, 120, 142" OS 01 59OO, D ,054, GOI 620, Catostomus snyderi, 142 OS 01 5900, E, 055, G01621 , Catostomus snyderi, complete OS 01 5899,, 056, GFOl622, Catostomus snyderi, complete OS 01 5900, F, 057, G01623, Catostomus snyderi, complete OS 015 9OO, G, O58, GOl649, Catostomus snyderiYw41,2 0, 142" OS 01 5900, H, 059, G01648, Catostomus snyderi, complete OS 01 5900,1,060, G01647, Catostomus snyderi, complete OS 015 900, J, 061 , GO1 646, Catostomus snyderiYw41,4 2" OS 015 901, AY062, G016 45, Catostomus snyderi, l OS 01 5901 , B, 063, G01644, Catostomus snyderiIw4, 120, 142" OS 015 901, CY064, G016 43, Catostomus snyderiYw41,8 4, 142" OS 015 901, DY065, G0614 2, Catostomus snyderi, complete OS 01 5901 , E, 066, G01641 , Catostomus snyderi," 4,120,142" OS 01 5901 , F, 067, G01 640, Catostomus snyderi, complete OS 015 901 , GY068, G016 39, Catostomus snyderiYw41,4 2" OS 01 5901 , H, 069, G01638, Catostomus snyderi, complete OS 01 5901,1,070, G01637, Catostomus snyderi, complete OS 01 5901 , J, 071 , GO1 636, Catostomus snyderi, no OS 01 5901 , K, 072, G01635, Catostomus snyderi, complete OS 015 901, L, 073, G01632, Catostomsunsy deri, complete OS 015 901, M, 074, G01626, Catostomsunsy deri, complete OS 01 5901 , N, 075, GF0165O, Catostomus snyderi, complete Lower Williamson River: OS 01 5896,, 082, G01631 , Catostomus snyderi, complete OS 01 5965, A, 031 , GO1 61 2, Chasmistes brevirostris, complete OS 01 5965, B ,032, GOI 61 3, Chasmistes brevirostris, complete OS 01 5959, A, 035, GF01609, Chasmistes brevirostris, complete OS 01 5959, B, 036, GFOl611 , Chasmistes brevirostris, complete OS 01 5965, C, 037, GF01614, Chasmistes brevirostris, complete OS 01 5959, C , O38, GOl6lO, Chasmistes brevirostris," 4, 1 84" OS 01 5963, A, O4O, BR00247, Chasmistes brevirostris, I 20 1 841 42 OS 01 5963, B ,041 , BR00248, Chasmistes brevirostris, complete OS 01 5963, C, 042, BR00249, Chasmistes brevirostris, complete OS 01 5963, D ,043, BR00250, Chasmistes brevirostris, complete OS 01 5964, A, 044,01825, Chasmistes brevirostris, complete OS 01 5964, B , O45,? 01826, Chasmistes brevirostris, complete OS 01 5964, C, 046,? 01827, Chasmistes brevirostris, complete OS 01 7480,, 047,? 01828, Chasmistes brevirostris, complete OS 01 5930,, 039, GF01615, Deltistes luxatus, complete OS 01 5931 , B, 048,? 01829, Deltistes luxatus, complete Upper Klamath Lake: OS 01 7490,, 289, BR00708, Catostomus rimiculus, complete OS 01 5954, A, 001 , GF01540, Chasmistes brevirostris, complete OS 01 5954, B, 004, GF01543, Chasmistes brevirostris," 4, 120" OS 01 5960,, 005, GF01544, Chasmistes brevirostris, complete OS 01 5952,, 013, G01546, Chasmistes brevirostris, complete OS 01 5953, A, 014, G01547, Chasmistes brevirostris, complete OS 01 5953, B ,015, G01548, Chasmistes brevirostris, complete OS 01 5961 , A, 287, BR00704, Chasmistes brevirostris, complete OS 01 5961 , B ,288, BR00706, Chasmistes brevirostris, complete OS 01 5961 , D ,29O, BROO7ll , Chasmistes brevirostris, complete OS 01 7479,, 295, BR00712, Chasmistes brevirostris, complete OS 01 5961 , F, 296, BR00713, Chasmistes brevirostris," 4, 184, 142" OS 01 5961 , G, 3OO, BROO7l5, Chasmistes brevirostris, complete OS 01 5962,, 307, BR00719, Chasmistes brevirostris," 4, 142" OS 01 5922,, 002, GF01541 , Deltistes luxatus, complete OS 01 5927,, 003, GF01542, Deltistes luxatus, complete OS 01 5926,, 006, GFOl545, Deltistes luxatus, complete OS 01 5928, A, 291 , BR00702, Deltistes luxatus, 4 OS 01 5928, B ,292, BR00703, Deltistes luxatus, complete OS 01 5928, C ,293, BR00705, Deltistes luxatus, complete OS 01 5928, D, 294, BR00707, Deltistes luxatus, complete OS 01 5928, F, 297, BR00709, Deltistes luxatus, complete OS 01 5928, G, 298, BR0071O, Deltistes luxatus, complete OS 015 928, HY299, BR00714 , Deltistes luxatus, complete OS 01 7491 ,, 301 , BR00716, Deltistes luxatus, complete OS 01 5929, A, 302, BR00720, Deltistes luxatus," 4, 1 84, 142" OS 01 5929, B ,303, BR00721 , Deltistes luxatus, complete OS 01 5929, C, 304, BR00722, Deltistes luxatus, complete OS 01 5929, D ,305, BR00724, Deltistes luxatus, complete OS 015 929, EY306, BR00725, Deltisteslu xatus, complete Lost River: nonletha1,, 008, NAYChasmistesb revirosfris, complete nonletha1,, 007, NA, Deltistes luxatus, complete nonletha1,, 009, GF5595, Deltistes luxatus, complete nonlethal,, Ol O, NA, Deltistes luxatus, complete nonlethal,, Ol I, 7 F7B1 C713F, Deltistes luxatus, no OS 01 7478,, 012,7F7BI F3269, Deltistes luxatus," 4, 142" Gerber Reservoir: OS 01 5892, A, 079, NA, Catostomus snyderi," 4,142" OS 01 5892, B, 080, GF01627, Catostomus snyderi, complete nonlethal,, 085, NA, Catostomus snyderi, no OS 015 943, AY18 7, BR00952, Chasmistes brevirostris, no OS 01 5943, B, 1 88, BR00953, Chasmistes brevirostris," 4, 142" OS 01 5949, A, 189, BR00954, Chasmistes brevirostris, complete OS 01 5949, B, 1 90, BR00955, Chasmistes brevirostris, no OS 01 5949, C, 191 , BR00956, Chasmistes brevirostris, complete OS 01 5949, D , I 92, BR00957, Chasmistes brevirostris, complete OS 01 5949, E, 193, BR00958, Chasmistes brevirostris, complete OS 01 5949, F, 194, BR00959, Chasmistes brevirostris, complete ' 0s 01 5949, G, 195, BR00960, Chasmistes brevirostris, complete OS 01 5949, H, 196, BR00961 , Chasmistes brevirostris, complete OS 01 5946, A, 1 97, BR00969, Chasmistes brevirostris, complete OS 01 5946, B, 1 98, BR00970, Chasmistes brevirostris, complete OS 01 5946, C , I 99, BR00971 , Chasmistes brevirostris, complete OS 01 5947, A, 207, BR00972, Chasmistes brevirostris, complete OS 01 5947, B ,208, BR00973, Chasmistes brevirostris, complete OS 01 5947, C, 209, BR00974, Chasmistes brevirostris," 4, 184, 142" OS 01 5947, D, 21 O, BROO975, Chasmistes brevirostris," 4, 142" OS 015 947, E ,211 , GF0180OYChasmistesb revirostris, complete OS 01 5947, F ,212, GFOI 801 , Chasmistes brevirostris, complete OS 01 5947, G, 213, G F01802, Chasmistes brevirostris, complete OS 01 5947, H, 214, GFOI 803, Chasmistes brevirostris, complete OS 01 5947,1,215, GF01804, Chasmistes brevirostris, complete OS 01 5947, J, 21 6, GF01805, Chasmistes brevirostris, complete OS 01 5948, A, 21 7, GF01806, Chasmistes brevirostris, complete OS 01 5948, B ,218, G F01807, Chasmistes brevirostris, complete OS 01 5944, A, 231, BR00734, Chasmistes brevirostris, no OS 01 5944, B, 232, BR00735, Chasmistes brevirostris, no OS 01 5944, C, 233, BR00736, Chasmistes brevirostris, no OS 01 5944, D ,234, BR00737, Chasmistes brevirostris, no OS 01 5944, E, 235, BR00738, Chasmistes brevirostris, no Clear Lake Reservoir: OS 01 5966, A, 086, GF01652, Chasmistes brevirostri~~ complete OS 01 5966, B, 087, GFOl653, Chasmistes brevirostris, complete OS 015 966, CY088, GF016 54, Chasmistes brevirostris, complete OS 01 5966, DY089, GF016 55, Chasmistes brevirostris, complete OS 015 966, EY090, GF016 56, Chasmistes brevirostris, complete OS 01 5966, F, 091 , GF01657, Chasmistes brevir~ stris~ complete OS 015 966, GY092, GF016 58, Chasmistes brevirostris, complete OS 01 5966, H, 093, G01659, Chasmistes brevirostris, complete OS 015 966, Iy094, GF016 60, Chasmistes brevirostris, complete OS 01 5966, J, 095, GF01661 , Chasmistes brevirostris, complete OS 01 5966, K, 096, GF01662, Chasmistes brevirostri~~ complete OS 015 966, LY097, GF016 63, Chasmistes brevirostris, complete OS 01 5966, M, 098, GF01664, Chasmistes brevirostris, complete OS 01 5966, N, 099, GF01665, Chasmistes brevirostris, complete OS 01 5969, A, 1 00, GFOI 667, Chasmistes brevirostris, complete OS 01 5969, B, 101 , GF01668, Chasmistes brevirostri~~ complete OS 01 5969, C, 102, GF01669, Chasmistes brevirostris, complete OS 01 5969, D, 103, GF0167O, Chasmistes brevirostris, complete OS 01 5969, E, 107, GF01673, Chasmistes brevirostris, complete OS 01 5969, F, 1 O8, GFOl674, Chasmistes brevirostris," 4, 1 20" OS 01 5969, G, 109, GF01676, Chasmistes brevirostris, complete OS 01 5969, H, 110, G01677, Chasmistes brevirostris, complete OS 01 5969, l, 1 1 1 , GF01678, Chasmistes brevirostris, complete OS 01 5969, J, 112, GF01679, Chasmistes brevirostris, complete OS 01 5969, K, 113, GF01680, Chasmistes brevirostris, complete OS 01 5967, A, 1 14, GFOl794, Chasmistes brevirostris, complete OS 01 5967, B, 115, GF01799, Chasmistes brevirostris, complete OS 01 5967, CY11 6, GF01798, Chasmistes brevirostris, complete OS 01 5967, D, 1 17, GF01797, Chasmistes brevirostris, complete OS 01 5967, E, 1 l8, GFOl796, Chasmistes brevirostris," 4, 120, 184" OS 01 5967, F, 1 19, GF01795, Chasmistes brevirostris, complete OS 01 5934, A, 1 25, G R01775, Chasmistes brevirostris, complete OS 01 5934, B, 126, GFOl776, Chasmistes brevirostris, complete OS 01 5934, C, 1 27, GF01777, Chasmistes brevirostris, complete OS 01 5934, D, 128, GF01778, Chasmistes brevirostris, complete OS 01 5934, E, l29, GFOl779, Chasmistes brevirostris," 4, 120" OS 01 5934, F, 130, GFOI 780, Chasmistes brevirostri~~ complete OS 01 5934, G, 1 31 , GF01781 , Chasmistes brevirostris, complete OS 01 5934, H, 132, GFOl782, Chasmistes brevirostri~~ complete OS 01 5934,1,133, GF01783, Chasmistes brevirostris, complete OS 01 5934, K, 135, GFO'l785, Chasmistes brevirostris, complete OS 01 5934, L, 136, GFOl786, Chasmistes brevirostri~~ complete OS 01 5934, M, 1 37, GF01875, Chasmistes brevirostris, no OS 01 7477,, 139, GFOI 877, Chasmistes brevirostris, 142 OS 01 5934, N, 1 63, BROlOOO, Chasmistes brevirostris," 4, 120, 1 84" OS 01 5934,0,164, BR00999, Chasmistes brevirostris, complete OS 01 5934, P ,165, BR00998, Chasmistes brevirostris, complete OS 01 5934, Q, 166, BR00997, Chasmistes brevirostris, complete OS 01 5934, R, 167, BR00996, Chasmistes brevirostris, complete OS 01 5934, S, 168, BR00995, Chasmistes brevirostris," 4, 142" OS 01 5934, T, 169, BR00994, Chasmistes brevirostris, complete OS 01 5934, U, 170, BR00993, Chasmistes brevirostris, complete OS 01 5934, V, 171 , BR00991 , Chasmistes brevirostris, no OS 01 5934, W, 172, BR00990, Chasmistes brevirostris, complete OS 01 5939, A, 242, BR00746, Chasmistes brevirostris, complete OS 01 5939, B, 243, BR00752, Chasmistes brevirostris, complete OS 01 5939, C, 244, BR00753, Chasmistes brevirostris," 4, 120, 142" OS 01 5939, D ,245, BR00754, Chasmistes brevirostris," 4, 120" OS 01 5939, E ,246, BR00755, Chasmistes brevirostris, complete OS 01 5937, A, 250, BR00759, Chasmistes brevirostris, no OS 01 5937, B ,251 , BR00760, Chasmistes brevirostris, complete OS 01 5937, C, 252, BR00761 , Chasmistes brevirostris, complete OS 01 5937, D, 253, BR00762, Chasmistes brevirostris, complete OS 015937, E, 254, BR00763, Chasmistes brevirostris, complete OS 01 5933, A, 258, BR00767, Chasmistes brevirostris, complete OS 01 5933, B, 259, BR00768, Chasmistes brevirostris," 4, 142" OS 01 5933, C, 260, BR00769, Chasmistes brevirostris, complete OS 01 5933, D ,261 , BR00770, Chasmistes brevirostriq4 OS 01 5933, E, 262, BR00771 , Chasmistes brevirostris, complete OS 01 5936, A, 263, BR00773, Chasmistes brevirostris, complete OS 01 5936, B ,264, BR00774, Chasmistes brevirostris," 4, 120" OS 01 5936, C, 265, GF07924, Chasmistes brevirostris, complete OS 01 5936, D ,268, GF01922, Chasmistes brevirostris, complete OS 01 5938,, 269, GFOl921 , Chasmistes brevirostris, complete OS 01 7489,, 134, GF01784, Deltistes / uxatus, complete OS 01 591 6, A, 1 38, GFOl876, Deltistes luxatus, complete OS 01 591 6, C, 140, GF01878, Deltistes luxatus," 4, 120, 142" OS 01 591 6, D, 141 , GFOl879, Deltistes luxatus, complete OS 01 591 6, E, 142, GF01880, Deltistes luxatus," 4, 120" OS 01 591 6, F, 1 74, BR00989, Deltistes luxatus, 4 OS 01 591 6, G, 1 75, BR00988, Deltistes luxatus, complete OS 01 591 6, H, 176, BROO987, Deltistes luxatus, complete OS 01 591 6,1,177, BR00986, Deltistes luxatus, no OS 01 591 5, A, 247, BR00756, Deltistes luxatus, complete OS 01 591 5, B ,248, BR00757, Deltistes luxatus, complete OS 01 591 5, C, 249, BR00758, Deltistes luxatus," 4, 120" OS 01 5920, A, 255, BR00764, Deltistes luxatus, complete OS 01 5920, B, 256, BR00765, Deltistes luxatus," 4, 1 20, 184" OS 01 5920, C, 257, BR00766, Deltistes luxatus, complete OS 01 591 7,, 27O, GFOl923, i," 4, 120, 142" Topsy Reservoir: OS 01 5908, D ,076, G01633, Catostomus rimiculus, complete OS 01 59O8, A, 104, G01671 , Catostomus rimiculus, complete OS 01 5908, B1 105, GF01672, Catostomus rimiculus, complete OS 01 5908, C, 106, G01675, Catostornus rimiculus, complete OS 01 5906, A, 236, BR00740, Catostomus rimiculus, no OS 01 5906, B, 237, BR00742, Catostomus rimiculus, complete OS 01 591 1 ,, 266, BROO7l 8., Catostomus rimiculus," 4, 120, 184" OS 01 5909, A, 271 , BR00311 , Catostomus rimiculus, complete OS 01 5909, B, 272, BR00312, Catostomus rimiculus," 4, 120, 142" OS 01 59O9, C ,273, BROO3l3, Catostomus rimiculus, complete OS 01 59O9, D ,274, BR00314, Catostomus rimiculus," 4,120,142" OS 01 5909, E, 275, BR00315, Catostomus rimiculus, complete OS 01 5909, F ,276, BR00316, Catostomus rimiculus, complete OS 01 5909, G, 277, BR00317, Catostomus rimiculus, complete OS 01 5909, H, 278, BR00318, Catostomus rimiculus, complete OS 01 5909, 1,279, BR00319, Catostomus rimiculus, complete OS 01 5909, J1280, BR00320, Catostomus rimiculus," 4, 120" OS 01 59Og, K, 281 , BR00321 , Catostomus rimiculus," 4,184,142" OS 01 5909, L, 282, BR00322, Catostomus rimiculus, complete OS 01 5909, M, 283, BR00323, Catostomus rimiculus, complete OS 01 5909, N, 284, BR00324, Catostomus rimiculus, complete OS 01 5909,0,285, BR00325, Catostomus rimiculus, complete OS 01 59O9, P ,286, BROO7Ol , Catostomus rimiculus, complete OS 01 7476, A1267, BROO71 7., Catostomus ~ nyderi~ complete OS 01 7487, A, 238, BR00743, Chasmistes brevirostris, complete OS 01 7487, B, 239, BR00741 , Chasmistes brevirostris," 4, 120, 142" OS 01 7487, C, 240, BR00744, Chasmistes brevirostris, complete OS 01 7487, D, 241 , BR00745, Chasmistes brevirostris, complete Copco Reservoir: OS 015 905,, 225, BR00728, Catostomusr imiculus, no OS 01 5940, A, 219, GF01808, Chasmistes brevirostris, complete OS 01 5940, B ,220, G F01809, Chasmistes bre~ irostris~ complete OS 01 5940, C, 221 , GF0181O, Chasmistes brevir~ stris~ complete OS 01 5940, D ,222, GFOI 81 1 , Chasmistes brevirostris, complete OS 01 5940, E, 223, BR00727, Chasmistes brevirostris, complete OS 01 5940, F ,224, BR00726, Chasmistes brevirostris, no OS 015940, G, 226, BR00729, Chasmistes brevirostris, no OS 01 5941 , A, 227, BR00730, Chasmistes brevirostris, no OS 01 5941 , B, 228, BR00731 , Chasmistes brevirostris, no OS 01 5941 , C, 229, BR00732, Chasmistes brevirostris, no OS 01 5941 , D ,23O, BR00733, Chasmistes brevirostris, no Rogue River: OS 01 591 3, A, l43, GFOl88l , Catostomus rimi~ ulus~ complete OS 01 591 3, B, 144, GFO1882, Catostomus rimiculus, complete OS 01 591 3, C, 145, GF01883, Catostomus rimiculus, complete OS 015 913 , D , I4 6, GFOl884, Catostomus rimiculus, complete OS 01 591 3, E, 147, GF01885, Catostomus rimiculus, complete OS 01 591 3, F, 148, GF01886, Catostomus rimiculus, complete OS 01 591 3, G, 149, GF01887, Catostomus rimiculus, complete OS 01 5913, H, 150, GF01888, Catostomus rimiculus," 4, 120, 184" OS 01 591 3, l, l5l , GF01889, Catostomus rimiculus," 4, 120, 185" OS 015 913 , J, l~ 2, GFOl892, Catostomusri miculus," 4, 120, 186" OS 01 591 3, K, 153, GFO1893, Catostomus rimiculus, complete OS 015 913 , L, l~ 4, GFOl895, Catostomusri miculus," 4, 120" OS 01 591 3, M, 1 55, GF01890, Catostomus rimiculus, complete OS 01 591 3, N, 156, GF01891 , Catostomus rimiculus, complete OS 01 591 3, O, 1 57 , GF01894, Catostomus rimiculus, complete OS 01 591 3, P, 158, GF01896, Catostomus rimiculus, complete OS 01 591 3, Q, 159, GF01897, Catostomus rimiculus, complete OS 01 591 3, R, 1 60, GF01899, Catostomus rimiculus, complete OS 01 591 3, S, l6l , GF01898, Catostomus rimiculus, complete OS 01 591 3, T, 162, BR00976, Catostomus rimiculus, complete OS 01 591 3, U, 173, BR00978, Catostomus rimiculus, complete OS 01 591 3, V, 178, BR00979, Catostomus rimiculus, complete OS 01 591 3, W, 179, BR00977, Catostomus rimiculus, complete OS 01 591 3, Z2,180, BR00980, Catostomus rimiculus, complete OS 01 591 3, X, 181 , BR00981 , Catostomus rimiculus, complete OS 01 591 3, Y, 182, BR00982, Catostomus rimiculus, no OS 01 591 3, Z, 183, BR00983, Catostomus rimiculus, complete OS 01 591 3, Z1,184, BR00984, Catostomus rimiculus, complete OS 01 591 3, Z3,185, BR00985, Catostomus rimiculus, complete OS 01 591 3, Z4,186, BR00986, Catostomus rimiculus, complete Hatchery: OS 01 5950,, 081 , GF01651 , Chasmistes brevirostris," 4, 120, 184" Outgroups: OS catalog number, OSU freezer number, Genus species, Location OS 01 3656 A, 1 , Catostomus macrochielus/ tsiltcoosa, Woahink Lake OS 01 3656 8,2, Catostomus macrochielus/ tsiltcoosa, Woahink Lake OS 01 3656 C ,3, Catostomus macrochielus/ tsiltcoosa, Woahin k Lake OS 01 3908- 1,61 , Catostomus wallcanyon," Wall Canyon Crk, Nv." OS 01 3908- 2,62, Catostomus wallcanyon,' Wall Canyon Crk, Nv." OS 01 3908- 3,63, Catostomus wallcanyon," Wall Canyon Crk, Nv." OS 01 5279, l OOJyrauchen texanus, Dexter Hatchery OS 01 5279,101 Xyrauchen texanus, Dexter Hatchery OS 01 5279,102, Xyrauchen texanus, Dexter Hatchery OS 01 5623- 1,224, Cafostomus occidentalis, Larabee Crk. OS 01 5623- 2,225, Catostomus occidentalis, Larabee Crk. OS 01 5623- 3,226, Catostomus occidentalis, Larabee Crk. OS 01 5885a, 230, Catostomus macrochielusltsiltcoosa, Hood R. OS 01 5885b, 231 , Catostomus macrochielusltsiltcoosa, Hood R. Appendix 2: Each locus sequenced has an assigned locus number, statement about how complete the search was for a species marker, the original clone size ( bp), Primers (+ I-) d esigned for amplification, PCR product size ( bp), the concentration of MgC12 in the PCR reaction and annealing temperature ( OC) used. The clone sequence is reported with the primer sites underlined. The results of a Genbank blast " x" ( amino acid homology) search and a blast " n" ( nucleic acid homology) are reported. Locus 001 : PCR amplification in all Klamath species results in a strong single band. Sequence alignment showed that the first 70 bp were identical and then the sequences became confused as if there were another DNA type present. Possibly a tetraploid locus. Clone size: 334 bp. PCR product size: 254 bp. Primers: 1 R+: 5' ACA ACA CTC CCA ATC CTT ATT CTT T 3' 1 R-: 5' TCA CTG TAA ACT GAT AGC CCA AAC A 3' Mg++ Concentration: 2mM Annealing Temp: 52 OC Reverse Sequence: AAGTATACGTTCATTTAGAAGGGAAAGCAGATTTAAGATTCACTGTAAACTG ATAGCCCAAACAGGGACATCAACCCTGTACCCTCAGATTAGC GTTACTTGCTGAGCTACCCAGGCTCCTGAAAGCTTTGACACCCCCGTGAAT ATAAAGACAGTCCAGCCAATATGTGCACTTGACCTGTTGACTAAGTTAATTT CAAATCAAATCAAATCACTTTATTGTCACACTACCATTTTGA ACTCTACAAAGAATAAGGATTGGGAGTGTTGTCGTGCTCTTGGCAGGAAGG GAATGCTAAAAAAAAAGTGTGA Blastx Search: No significant amino acid sequence similarity found in Genbank. Blastn search: emb AL0218081 HS24Ol 8 Human DNA sequence from clone 2401 8 on chromosome 6~ 21.31- 22.2; zinc finger protein pseudogene. 60170 bp ( 85% identity), 24% overall identity. Locus 002: All Klamath catostomids species are identical at this locus. Clone size: 619 bp. PCR Product size: 501 bp. Primers: 2R+: 5' TTG TCG GAT GCA GTG AAA AGT CAG C3' 2R-: 5' GAT TAAGTT GGG TAA CGC CAGGTT T 3' Mg++ Concentration: 1 mM Annealing Temp: 52 OC forward Sequence: GCTGACTTTTCACTGCATCCGACAAAAACTGTClTTTGGTTGCCATGATATT AATGCCTGTCATTATCCATGTTATCATTTTACATAGTCATGGCAATATTATTG AGAAGTGAGCTTGATTTTCCTCTGGTGAAAGTTACATGGAGCCACATAATTA GGAACATCCCATTACAAAAATATATGGTTGTTCAAAAACCAAGTGAGCTGCT TCCAGATAGACAGCTGCCTTGTGTGGCAGTATCCTAATCATCATGGAACTTC ATAAATGACTGATTTAAAACACTACGTAAGCAGTAACTTTGCCACACAAATAG CTCTCCTCGTGTGCAGTGCACGGGAGACTCGCAGTTGATTTGCGAGGTGCA AGAGGATAGGATGTGATAATTTTCTCATAATTTACTCAAGCTGACTTTTCACT GCATCCGACAAACAACTGAGAATAGGCCAGTCATGGAGA NTTGGATGGGGACTGTGTTGTTCCGACCATTTGCCGATGTGGAATTTT Blastx search: gblAAD10590.11